Multiple sequence alignment - TraesCS7A01G548400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G548400 chr7A 100.000 2546 0 0 1 2546 722876444 722878989 0.000000e+00 4702.0
1 TraesCS7A01G548400 chr7A 99.529 2548 9 2 1 2546 722791909 722794455 0.000000e+00 4636.0
2 TraesCS7A01G548400 chr7A 85.280 1413 135 34 1178 2546 723074961 723076344 0.000000e+00 1389.0
3 TraesCS7A01G548400 chr7A 85.067 1413 143 37 1178 2546 722898728 722900116 0.000000e+00 1378.0
4 TraesCS7A01G548400 chr7A 84.784 1413 147 36 1178 2546 722988239 722989627 0.000000e+00 1356.0
5 TraesCS7A01G548400 chr7A 87.838 296 21 9 1178 1458 723031082 723031377 1.460000e-87 333.0
6 TraesCS7A01G548400 chr7A 92.778 180 12 1 987 1166 723030921 723031099 2.510000e-65 259.0
7 TraesCS7A01G548400 chr7A 93.182 176 11 1 991 1166 722936628 722936802 9.040000e-65 257.0
8 TraesCS7A01G548400 chr7A 92.571 175 13 0 987 1161 722898567 722898741 4.200000e-63 252.0
9 TraesCS7A01G548400 chr7A 92.571 175 13 0 987 1161 722988078 722988252 4.200000e-63 252.0
10 TraesCS7A01G548400 chr7A 88.073 218 11 6 963 1166 723074762 723074978 7.040000e-61 244.0
11 TraesCS7A01G548400 chr7A 98.400 125 2 0 1334 1458 722938443 722938567 1.190000e-53 220.0
12 TraesCS7A01G548400 chr7D 93.203 1795 84 19 754 2546 627298122 627299880 0.000000e+00 2604.0
13 TraesCS7A01G548400 chr7D 95.620 685 28 1 1 685 627296942 627297624 0.000000e+00 1098.0
14 TraesCS7A01G548400 chr7D 80.420 429 55 15 762 1166 627304920 627305343 1.480000e-77 300.0
15 TraesCS7A01G548400 chr7D 89.474 114 12 0 1178 1291 627305326 627305439 7.340000e-31 145.0
16 TraesCS7A01G548400 chr7B 92.794 1818 77 26 749 2546 728005460 728007243 0.000000e+00 2582.0
17 TraesCS7A01G548400 chr7B 85.359 1407 149 32 1178 2546 728012978 728014365 0.000000e+00 1404.0
18 TraesCS7A01G548400 chr7B 90.044 683 55 7 2 682 728004513 728005184 0.000000e+00 872.0
19 TraesCS7A01G548400 chr7B 81.324 423 55 12 762 1166 728012579 728012995 3.160000e-84 322.0
20 TraesCS7A01G548400 chr7B 83.590 195 21 9 2328 2519 728007498 728007684 3.370000e-39 172.0
21 TraesCS7A01G548400 chr7B 100.000 30 0 0 966 995 728212008 728212037 3.540000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G548400 chr7A 722876444 722878989 2545 False 4702.000000 4702 100.000000 1 2546 1 chr7A.!!$F2 2545
1 TraesCS7A01G548400 chr7A 722791909 722794455 2546 False 4636.000000 4636 99.529000 1 2546 1 chr7A.!!$F1 2545
2 TraesCS7A01G548400 chr7A 723074762 723076344 1582 False 816.500000 1389 86.676500 963 2546 2 chr7A.!!$F7 1583
3 TraesCS7A01G548400 chr7A 722898567 722900116 1549 False 815.000000 1378 88.819000 987 2546 2 chr7A.!!$F3 1559
4 TraesCS7A01G548400 chr7A 722988078 722989627 1549 False 804.000000 1356 88.677500 987 2546 2 chr7A.!!$F5 1559
5 TraesCS7A01G548400 chr7A 722936628 722938567 1939 False 238.500000 257 95.791000 991 1458 2 chr7A.!!$F4 467
6 TraesCS7A01G548400 chr7D 627296942 627299880 2938 False 1851.000000 2604 94.411500 1 2546 2 chr7D.!!$F1 2545
7 TraesCS7A01G548400 chr7D 627304920 627305439 519 False 222.500000 300 84.947000 762 1291 2 chr7D.!!$F2 529
8 TraesCS7A01G548400 chr7B 728004513 728007684 3171 False 1208.666667 2582 88.809333 2 2546 3 chr7B.!!$F2 2544
9 TraesCS7A01G548400 chr7B 728012579 728014365 1786 False 863.000000 1404 83.341500 762 2546 2 chr7B.!!$F3 1784

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
448 451 1.534163 CAACATCGGATATGGCTGCAG 59.466 52.381 10.11 10.11 0.0 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1553 3588 2.725206 CTGCTCGATCGATCTGTTGATG 59.275 50.0 19.78 4.51 32.19 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
448 451 1.534163 CAACATCGGATATGGCTGCAG 59.466 52.381 10.11 10.11 0.00 4.41
652 655 6.894339 TTTTGTTCCTTTTCCTATCTGGAC 57.106 37.500 0.00 0.00 46.14 4.02
1553 3588 1.145531 GGGGGAGGAGTAGTAGGAGTC 59.854 61.905 0.00 0.00 0.00 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
652 655 3.728076 TCACAGCGCCCTAACTATTAG 57.272 47.619 2.29 0.00 0.00 1.73
1553 3588 2.725206 CTGCTCGATCGATCTGTTGATG 59.275 50.000 19.78 4.51 32.19 3.07
1774 3829 4.639755 TCAAACACAATCTGACACACACAT 59.360 37.500 0.00 0.00 0.00 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.