Multiple sequence alignment - TraesCS7A01G548300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G548300 chr7A 100.000 2546 0 0 1 2546 722791909 722794454 0.000000e+00 4702.0
1 TraesCS7A01G548300 chr7A 99.529 2547 9 2 1 2546 722876444 722878988 0.000000e+00 4634.0
2 TraesCS7A01G548300 chr7A 85.420 1406 128 38 1178 2536 723074961 723076336 0.000000e+00 1389.0
3 TraesCS7A01G548300 chr7A 85.067 1413 142 38 1178 2546 722898728 722900115 0.000000e+00 1376.0
4 TraesCS7A01G548300 chr7A 84.784 1413 146 37 1178 2546 722988239 722989626 0.000000e+00 1354.0
5 TraesCS7A01G548300 chr7A 87.838 296 21 9 1178 1458 723031082 723031377 1.460000e-87 333.0
6 TraesCS7A01G548300 chr7A 93.333 180 11 1 987 1166 723030921 723031099 5.400000e-67 265.0
7 TraesCS7A01G548300 chr7A 93.750 176 10 1 991 1166 722936628 722936802 1.940000e-66 263.0
8 TraesCS7A01G548300 chr7A 93.143 175 12 0 987 1161 722898567 722898741 9.040000e-65 257.0
9 TraesCS7A01G548300 chr7A 93.143 175 12 0 987 1161 722988078 722988252 9.040000e-65 257.0
10 TraesCS7A01G548300 chr7A 88.532 218 10 6 963 1166 723074762 723074978 1.510000e-62 250.0
11 TraesCS7A01G548300 chr7A 98.400 125 2 0 1334 1458 722938443 722938567 1.190000e-53 220.0
12 TraesCS7A01G548300 chr7D 93.259 1795 82 19 754 2546 627298122 627299879 0.000000e+00 2608.0
13 TraesCS7A01G548300 chr7D 95.474 685 29 1 1 685 627296942 627297624 0.000000e+00 1092.0
14 TraesCS7A01G548300 chr7D 80.653 429 54 15 762 1166 627304920 627305343 3.180000e-79 305.0
15 TraesCS7A01G548300 chr7D 89.474 114 12 0 1178 1291 627305326 627305439 7.340000e-31 145.0
16 TraesCS7A01G548300 chr7B 92.629 1818 79 26 749 2546 728005460 728007242 0.000000e+00 2564.0
17 TraesCS7A01G548300 chr7B 85.227 1408 148 33 1178 2546 728012978 728014364 0.000000e+00 1393.0
18 TraesCS7A01G548300 chr7B 89.898 683 56 7 2 682 728004513 728005184 0.000000e+00 867.0
19 TraesCS7A01G548300 chr7B 81.560 423 54 12 762 1166 728012579 728012995 6.790000e-86 327.0
20 TraesCS7A01G548300 chr7B 82.273 220 27 11 2330 2546 728007498 728007708 2.010000e-41 180.0
21 TraesCS7A01G548300 chr7B 100.000 30 0 0 966 995 728212008 728212037 3.540000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G548300 chr7A 722791909 722794454 2545 False 4702.000000 4702 100.000000 1 2546 1 chr7A.!!$F1 2545
1 TraesCS7A01G548300 chr7A 722876444 722878988 2544 False 4634.000000 4634 99.529000 1 2546 1 chr7A.!!$F2 2545
2 TraesCS7A01G548300 chr7A 723074762 723076336 1574 False 819.500000 1389 86.976000 963 2536 2 chr7A.!!$F7 1573
3 TraesCS7A01G548300 chr7A 722898567 722900115 1548 False 816.500000 1376 89.105000 987 2546 2 chr7A.!!$F3 1559
4 TraesCS7A01G548300 chr7A 722988078 722989626 1548 False 805.500000 1354 88.963500 987 2546 2 chr7A.!!$F5 1559
5 TraesCS7A01G548300 chr7A 722936628 722938567 1939 False 241.500000 263 96.075000 991 1458 2 chr7A.!!$F4 467
6 TraesCS7A01G548300 chr7D 627296942 627299879 2937 False 1850.000000 2608 94.366500 1 2546 2 chr7D.!!$F1 2545
7 TraesCS7A01G548300 chr7D 627304920 627305439 519 False 225.000000 305 85.063500 762 1291 2 chr7D.!!$F2 529
8 TraesCS7A01G548300 chr7B 728004513 728007708 3195 False 1203.666667 2564 88.266667 2 2546 3 chr7B.!!$F2 2544
9 TraesCS7A01G548300 chr7B 728012579 728014364 1785 False 860.000000 1393 83.393500 762 2546 2 chr7B.!!$F3 1784

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
84 85 1.807165 CAGTGTGTCCATCGAGCGG 60.807 63.158 0.0 0.0 0.0 5.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1776 3829 4.097714 CAAACACAATCTGACACACACAC 58.902 43.478 0.0 0.0 0.0 3.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 6.432783 CGATGGAAATCTAGATCTAGTGGTCT 59.567 42.308 25.54 10.03 34.84 3.85
77 78 8.918202 TTTACTTTAAAGATCAGTGTGTCCAT 57.082 30.769 21.92 0.00 0.00 3.41
84 85 1.807165 CAGTGTGTCCATCGAGCGG 60.807 63.158 0.00 0.00 0.00 5.52
1770 3823 6.348498 TGAAGAGTGCAATTAAGCTGCTATA 58.652 36.000 0.90 0.00 40.59 1.31
1771 3824 6.994496 TGAAGAGTGCAATTAAGCTGCTATAT 59.006 34.615 0.90 0.00 40.59 0.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 9.403583 ACACACTGATCTTTAAAGTAAAAGGAA 57.596 29.630 14.74 0.0 37.13 3.36
77 78 1.227234 CCATATGTGTGCCGCTCGA 60.227 57.895 1.24 0.0 0.00 4.04
84 85 4.098654 ACTCACTAGTCTCCATATGTGTGC 59.901 45.833 1.24 0.0 0.00 4.57
1770 3823 7.105588 ACACAATCTGACACACACACATATAT 58.894 34.615 0.00 0.0 0.00 0.86
1771 3824 6.463360 ACACAATCTGACACACACACATATA 58.537 36.000 0.00 0.0 0.00 0.86
1776 3829 4.097714 CAAACACAATCTGACACACACAC 58.902 43.478 0.00 0.0 0.00 3.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.