Multiple sequence alignment - TraesCS7A01G547900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G547900 chr7A 100.000 3002 0 0 1 3002 722694158 722691157 0 5544
1 TraesCS7A01G547900 chr1A 98.236 3005 48 4 1 3002 21071717 21068715 0 5251
2 TraesCS7A01G547900 chr4A 97.506 3007 70 4 1 3002 593048215 593051221 0 5132
3 TraesCS7A01G547900 chr4A 97.473 3007 71 4 1 3002 592481331 592484337 0 5127
4 TraesCS7A01G547900 chr4A 97.439 3007 72 4 1 3002 592760137 592763143 0 5121
5 TraesCS7A01G547900 chr4A 97.439 3007 67 8 1 3002 591561906 591558905 0 5118
6 TraesCS7A01G547900 chr3A 97.506 3007 69 5 1 3002 42789829 42786824 0 5132
7 TraesCS7A01G547900 chr3A 97.438 3006 72 4 1 3002 450958886 450961890 0 5120
8 TraesCS7A01G547900 chr6A 97.443 3011 68 8 1 3002 87944998 87941988 0 5125
9 TraesCS7A01G547900 chr7B 97.409 3011 69 8 1 3002 666522665 666525675 0 5120


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G547900 chr7A 722691157 722694158 3001 True 5544 5544 100.000 1 3002 1 chr7A.!!$R1 3001
1 TraesCS7A01G547900 chr1A 21068715 21071717 3002 True 5251 5251 98.236 1 3002 1 chr1A.!!$R1 3001
2 TraesCS7A01G547900 chr4A 593048215 593051221 3006 False 5132 5132 97.506 1 3002 1 chr4A.!!$F3 3001
3 TraesCS7A01G547900 chr4A 592481331 592484337 3006 False 5127 5127 97.473 1 3002 1 chr4A.!!$F1 3001
4 TraesCS7A01G547900 chr4A 592760137 592763143 3006 False 5121 5121 97.439 1 3002 1 chr4A.!!$F2 3001
5 TraesCS7A01G547900 chr4A 591558905 591561906 3001 True 5118 5118 97.439 1 3002 1 chr4A.!!$R1 3001
6 TraesCS7A01G547900 chr3A 42786824 42789829 3005 True 5132 5132 97.506 1 3002 1 chr3A.!!$R1 3001
7 TraesCS7A01G547900 chr3A 450958886 450961890 3004 False 5120 5120 97.438 1 3002 1 chr3A.!!$F1 3001
8 TraesCS7A01G547900 chr6A 87941988 87944998 3010 True 5125 5125 97.443 1 3002 1 chr6A.!!$R1 3001
9 TraesCS7A01G547900 chr7B 666522665 666525675 3010 False 5120 5120 97.409 1 3002 1 chr7B.!!$F1 3001

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
934 937 1.130373 CGTGCACCGCTATTGTCAATT 59.870 47.619 12.15 0.0 0.00 2.32 F
1204 1209 1.418637 GTAGTGAGGGGTTCAACACCA 59.581 52.381 12.63 0.0 46.63 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1947 1953 0.767375 GATGAGCCCCCTGATTGCTA 59.233 55.000 0.0 0.0 34.99 3.49 R
2350 2361 1.272313 ACTAGGTAGCCTGTTCGGTGA 60.272 52.381 0.0 0.0 34.61 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 214 2.159462 GCTTCTTGTGCACCTAGATTGC 60.159 50.000 15.69 17.85 40.63 3.56
246 247 4.695455 GCAACTACACAATGTCCTGTATGT 59.305 41.667 0.00 0.00 0.00 2.29
276 277 6.708502 ACTGCAAAGTGTTTTTAAAAAGGTGT 59.291 30.769 13.58 0.00 0.00 4.16
531 534 6.408548 GGAGGGTGATCTGATTGAGACAATTA 60.409 42.308 0.00 0.00 31.75 1.40
533 536 6.070021 AGGGTGATCTGATTGAGACAATTACA 60.070 38.462 0.00 0.00 31.75 2.41
796 799 4.547859 GCAGGAGTTGGCATCGAT 57.452 55.556 0.00 0.00 0.00 3.59
894 897 2.487934 GTGCGATGAGGCAGTCAATAT 58.512 47.619 0.00 0.00 44.93 1.28
925 928 3.931247 AACCACCGTGCACCGCTA 61.931 61.111 12.15 0.00 34.38 4.26
931 934 1.739929 CCGTGCACCGCTATTGTCA 60.740 57.895 12.15 0.00 34.38 3.58
934 937 1.130373 CGTGCACCGCTATTGTCAATT 59.870 47.619 12.15 0.00 0.00 2.32
977 980 2.696187 GGAAAAGGTTGGTTGGTTGCTA 59.304 45.455 0.00 0.00 0.00 3.49
1204 1209 1.418637 GTAGTGAGGGGTTCAACACCA 59.581 52.381 12.63 0.00 46.63 4.17
1373 1378 7.363268 CCCAATAGAGAAGCAAGCTTACAAAAT 60.363 37.037 7.37 0.00 36.26 1.82
1502 1507 5.868801 AGGAATTTGTTGCGAAATATGGTTG 59.131 36.000 0.00 0.00 0.00 3.77
1715 1721 5.240713 GGTTATGAGCAACCAGATGAAAG 57.759 43.478 0.17 0.00 46.14 2.62
1741 1747 6.297582 CCTCCTCAATCAAAGAAGCAGATAT 58.702 40.000 0.00 0.00 0.00 1.63
2106 2114 1.278637 GCGCACGCTGTGTTAGTTT 59.721 52.632 7.96 0.00 35.75 2.66
2218 2228 4.899239 GCATCCTCCGCCACCTCG 62.899 72.222 0.00 0.00 0.00 4.63
2350 2361 2.555325 CACACATCATGGTGCTCAGTTT 59.445 45.455 5.69 0.00 42.55 2.66
2534 2545 0.533032 GACCTACAGGCAGGACTCAC 59.467 60.000 0.00 0.00 39.18 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 5.704978 TCAAGTTGCAGTTATACAAGATGCA 59.295 36.000 0.00 0.0 44.58 3.96
276 277 2.170607 GCAGGAAATGGACACCTAGCTA 59.829 50.000 0.00 0.0 32.35 3.32
796 799 3.157087 GCTCCAAAGACCCAATCAAAGA 58.843 45.455 0.00 0.0 0.00 2.52
894 897 2.354704 CGGTGGTTGGAAAGATGCTCTA 60.355 50.000 0.00 0.0 0.00 2.43
925 928 7.094975 CCTTTTTCATGATGTGCAATTGACAAT 60.095 33.333 10.34 0.0 0.00 2.71
931 934 4.901868 AGCCTTTTTCATGATGTGCAATT 58.098 34.783 0.00 0.0 0.00 2.32
934 937 2.892215 TGAGCCTTTTTCATGATGTGCA 59.108 40.909 0.00 0.0 0.00 4.57
977 980 0.692419 AGAGTCCTGGATTCCGGCAT 60.692 55.000 14.83 0.0 0.00 4.40
1027 1030 3.568430 TGCTCAAACTCGTCTAGTGAAGA 59.432 43.478 0.00 0.0 38.88 2.87
1204 1209 5.888161 GTGGGTTCACATATCTTTTGAGGAT 59.112 40.000 0.00 0.0 43.13 3.24
1502 1507 1.798813 CCTGCACCAAGTAGTTTCGAC 59.201 52.381 0.00 0.0 0.00 4.20
1715 1721 1.747924 GCTTCTTTGATTGAGGAGGCC 59.252 52.381 0.00 0.0 0.00 5.19
1741 1747 4.736473 TCGTATATCATGTTCCTCTCCCA 58.264 43.478 0.00 0.0 0.00 4.37
1947 1953 0.767375 GATGAGCCCCCTGATTGCTA 59.233 55.000 0.00 0.0 34.99 3.49
2106 2114 7.331026 AGTTAGCTGTGTTATCTTGATGCTTA 58.669 34.615 0.00 0.0 0.00 3.09
2293 2304 3.264450 AGACCTAGTTTGATGGGGAGTTG 59.736 47.826 0.00 0.0 0.00 3.16
2350 2361 1.272313 ACTAGGTAGCCTGTTCGGTGA 60.272 52.381 0.00 0.0 34.61 4.02
2420 2431 4.080863 CCTATAGGCAGAACAGGACAAACT 60.081 45.833 5.67 0.0 0.00 2.66
2534 2545 1.921869 AACCTGGGTTATGAGCCCCG 61.922 60.000 2.85 0.0 45.49 5.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.