Multiple sequence alignment - TraesCS7A01G547800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G547800 chr7A 100.000 2661 0 0 1 2661 722692712 722690052 0 4915
1 TraesCS7A01G547800 chr6A 97.559 2663 61 4 1 2661 494428579 494431239 0 4554
2 TraesCS7A01G547800 chr6A 96.814 2668 76 4 1 2661 184602839 184600174 0 4447
3 TraesCS7A01G547800 chr3A 96.964 2668 70 6 1 2661 450960335 450962998 0 4468
4 TraesCS7A01G547800 chr2B 96.853 2669 53 17 1 2661 608457621 608460266 0 4434
5 TraesCS7A01G547800 chr4A 97.126 2436 60 7 233 2661 578204259 578201827 0 4102
6 TraesCS7A01G547800 chr2D 93.493 2674 142 26 1 2661 536211805 536214459 0 3945
7 TraesCS7A01G547800 chr4D 93.231 2674 150 25 1 2661 65873179 65870524 0 3906
8 TraesCS7A01G547800 chr7D 92.972 2675 149 29 1 2661 135382666 135385315 0 3862
9 TraesCS7A01G547800 chr1A 95.599 409 18 0 2253 2661 365637139 365637547 0 656


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G547800 chr7A 722690052 722692712 2660 True 4915 4915 100.000 1 2661 1 chr7A.!!$R1 2660
1 TraesCS7A01G547800 chr6A 494428579 494431239 2660 False 4554 4554 97.559 1 2661 1 chr6A.!!$F1 2660
2 TraesCS7A01G547800 chr6A 184600174 184602839 2665 True 4447 4447 96.814 1 2661 1 chr6A.!!$R1 2660
3 TraesCS7A01G547800 chr3A 450960335 450962998 2663 False 4468 4468 96.964 1 2661 1 chr3A.!!$F1 2660
4 TraesCS7A01G547800 chr2B 608457621 608460266 2645 False 4434 4434 96.853 1 2661 1 chr2B.!!$F1 2660
5 TraesCS7A01G547800 chr4A 578201827 578204259 2432 True 4102 4102 97.126 233 2661 1 chr4A.!!$R1 2428
6 TraesCS7A01G547800 chr2D 536211805 536214459 2654 False 3945 3945 93.493 1 2661 1 chr2D.!!$F1 2660
7 TraesCS7A01G547800 chr4D 65870524 65873179 2655 True 3906 3906 93.231 1 2661 1 chr4D.!!$R1 2660
8 TraesCS7A01G547800 chr7D 135382666 135385315 2649 False 3862 3862 92.972 1 2661 1 chr7D.!!$F1 2660

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
933 938 0.462047 GGCTACCTAGTTGCGCATGT 60.462 55.0 12.75 3.63 35.33 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2155 2187 0.953471 TTCGCACTGCTTAACGCCAT 60.953 50.0 0.0 0.0 38.05 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 5.868801 AGGAATTTGTTGCGAAATATGGTTG 59.131 36.000 0.00 0.00 0.00 3.77
269 270 5.240713 GGTTATGAGCAACCAGATGAAAG 57.759 43.478 0.17 0.00 46.14 2.62
295 296 6.297582 CCTCCTCAATCAAAGAAGCAGATAT 58.702 40.000 0.00 0.00 0.00 1.63
772 776 4.899239 GCATCCTCCGCCACCTCG 62.899 72.222 0.00 0.00 0.00 4.63
904 908 2.555325 CACACATCATGGTGCTCAGTTT 59.445 45.455 5.69 0.00 42.55 2.66
933 938 0.462047 GGCTACCTAGTTGCGCATGT 60.462 55.000 12.75 3.63 35.33 3.21
1088 1093 0.533032 GACCTACAGGCAGGACTCAC 59.467 60.000 0.00 0.00 39.18 3.51
1185 1192 2.637382 TCATAGTGCCCAGTTGAACAGA 59.363 45.455 0.00 0.00 0.00 3.41
1895 1913 5.692115 TCCAGTGCTCCTAATGTATCAAA 57.308 39.130 0.00 0.00 0.00 2.69
1984 2002 8.956533 ATAAAATTGTACAAACCAGCAACTTT 57.043 26.923 13.23 2.42 0.00 2.66
2155 2187 1.066430 GTTGGCTACCATTCCACTCGA 60.066 52.381 0.00 0.00 31.53 4.04
2319 2356 2.733227 GCAACTCATTATGTGCCACTGC 60.733 50.000 0.00 0.00 38.26 4.40
2363 2400 1.933853 CAACTACTTATGCGCCACTCC 59.066 52.381 4.18 0.00 0.00 3.85
2630 2669 3.636929 TACTGCCCCCGCAATGGTG 62.637 63.158 0.00 0.00 46.66 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
11 12 0.784778 GTTCGGTCTGAGCTCAAACG 59.215 55.000 22.33 22.33 0.00 3.60
56 57 1.798813 CCTGCACCAAGTAGTTTCGAC 59.201 52.381 0.00 0.00 0.00 4.20
140 141 1.076024 ACACCTTGAGGATGTGGCAAT 59.924 47.619 3.59 0.00 38.94 3.56
269 270 1.747924 GCTTCTTTGATTGAGGAGGCC 59.252 52.381 0.00 0.00 0.00 5.19
295 296 4.736473 TCGTATATCATGTTCCTCTCCCA 58.264 43.478 0.00 0.00 0.00 4.37
501 502 0.767375 GATGAGCCCCCTGATTGCTA 59.233 55.000 0.00 0.00 34.99 3.49
904 908 1.272313 ACTAGGTAGCCTGTTCGGTGA 60.272 52.381 0.00 0.00 34.61 4.02
933 938 5.743026 TTTTGATGCTCGAACTAACACAA 57.257 34.783 0.00 0.00 0.00 3.33
974 979 4.080863 CCTATAGGCAGAACAGGACAAACT 60.081 45.833 5.67 0.00 0.00 2.66
1088 1093 1.921869 AACCTGGGTTATGAGCCCCG 61.922 60.000 2.85 0.00 45.49 5.73
1185 1192 0.523072 CGCAACTAGGCAGCATGTTT 59.477 50.000 0.00 0.00 39.31 2.83
1895 1913 8.981647 GTTTGCAACTCAATATCATCACTTTTT 58.018 29.630 0.00 0.00 34.12 1.94
2155 2187 0.953471 TTCGCACTGCTTAACGCCAT 60.953 50.000 0.00 0.00 38.05 4.40
2546 2585 6.832384 AGCACTTCCAGATTATTGACATTGAT 59.168 34.615 0.00 0.00 0.00 2.57
2630 2669 2.109126 GCTGATGAACACCGCCTCC 61.109 63.158 0.00 0.00 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.