Multiple sequence alignment - TraesCS7A01G545600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G545600 chr7A 100.000 3938 0 0 1 3938 721663302 721659365 0.000000e+00 7273.0
1 TraesCS7A01G545600 chr7A 99.644 3936 12 2 1 3934 721588648 721584713 0.000000e+00 7190.0
2 TraesCS7A01G545600 chr7D 93.348 1819 70 16 1235 3019 626052303 626050502 0.000000e+00 2641.0
3 TraesCS7A01G545600 chr7D 96.216 1242 38 7 1 1233 626053575 626052334 0.000000e+00 2025.0
4 TraesCS7A01G545600 chr7D 88.922 668 63 9 1812 2470 626031036 626030371 0.000000e+00 813.0
5 TraesCS7A01G545600 chr7D 83.099 142 14 3 1310 1451 626031474 626031343 1.920000e-23 121.0
6 TraesCS7A01G545600 chr7B 89.316 2031 135 31 1237 3231 725853375 725855359 0.000000e+00 2473.0
7 TraesCS7A01G545600 chr7B 94.378 498 21 2 735 1225 725852829 725853326 0.000000e+00 758.0
8 TraesCS7A01G545600 chr7B 89.189 222 13 3 999 1220 232271722 232271512 2.330000e-67 267.0
9 TraesCS7A01G545600 chr1D 87.210 1079 114 20 1930 3002 25956482 25955422 0.000000e+00 1206.0
10 TraesCS7A01G545600 chr1D 85.802 324 27 9 901 1216 25957760 25957448 3.790000e-85 326.0
11 TraesCS7A01G545600 chr1D 88.387 155 18 0 2783 2937 452348403 452348557 1.870000e-43 187.0
12 TraesCS7A01G545600 chr1B 86.784 1082 114 22 1929 3002 41642885 41641825 0.000000e+00 1179.0
13 TraesCS7A01G545600 chr1B 83.102 722 108 13 1967 2681 622180776 622180062 0.000000e+00 645.0
14 TraesCS7A01G545600 chr1B 96.020 201 8 0 999 1199 41644207 41644007 1.060000e-85 327.0
15 TraesCS7A01G545600 chr1A 86.368 1093 116 15 1923 3002 27259658 27260730 0.000000e+00 1162.0
16 TraesCS7A01G545600 chr1A 87.240 337 26 12 875 1200 27258285 27258615 6.220000e-98 368.0
17 TraesCS7A01G545600 chr3A 82.483 725 125 2 1958 2681 744195235 744194512 5.550000e-178 634.0
18 TraesCS7A01G545600 chr6D 93.627 204 12 1 995 1198 425870796 425870998 1.780000e-78 303.0
19 TraesCS7A01G545600 chr3B 89.744 156 16 0 2783 2938 817352002 817351847 2.400000e-47 200.0
20 TraesCS7A01G545600 chr3D 89.103 156 17 0 2783 2938 607665949 607665794 1.120000e-45 195.0
21 TraesCS7A01G545600 chr3D 86.250 160 18 3 3295 3452 505776272 505776429 1.880000e-38 171.0
22 TraesCS7A01G545600 chr5D 93.130 131 9 0 993 1123 165177916 165177786 4.020000e-45 193.0
23 TraesCS7A01G545600 chr5A 90.385 52 5 0 3712 3763 558688189 558688240 7.060000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G545600 chr7A 721659365 721663302 3937 True 7273.0 7273 100.0000 1 3938 1 chr7A.!!$R2 3937
1 TraesCS7A01G545600 chr7A 721584713 721588648 3935 True 7190.0 7190 99.6440 1 3934 1 chr7A.!!$R1 3933
2 TraesCS7A01G545600 chr7D 626050502 626053575 3073 True 2333.0 2641 94.7820 1 3019 2 chr7D.!!$R2 3018
3 TraesCS7A01G545600 chr7D 626030371 626031474 1103 True 467.0 813 86.0105 1310 2470 2 chr7D.!!$R1 1160
4 TraesCS7A01G545600 chr7B 725852829 725855359 2530 False 1615.5 2473 91.8470 735 3231 2 chr7B.!!$F1 2496
5 TraesCS7A01G545600 chr1D 25955422 25957760 2338 True 766.0 1206 86.5060 901 3002 2 chr1D.!!$R1 2101
6 TraesCS7A01G545600 chr1B 41641825 41644207 2382 True 753.0 1179 91.4020 999 3002 2 chr1B.!!$R2 2003
7 TraesCS7A01G545600 chr1B 622180062 622180776 714 True 645.0 645 83.1020 1967 2681 1 chr1B.!!$R1 714
8 TraesCS7A01G545600 chr1A 27258285 27260730 2445 False 765.0 1162 86.8040 875 3002 2 chr1A.!!$F1 2127
9 TraesCS7A01G545600 chr3A 744194512 744195235 723 True 634.0 634 82.4830 1958 2681 1 chr3A.!!$R1 723

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
586 590 1.05666 GGGAGGACAAGAACCACTCA 58.943 55.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3132 3933 7.739911 CGAATTTAACGATCGATTGCATTCATA 59.26 33.333 24.34 0.0 38.82 2.15 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
586 590 1.056660 GGGAGGACAAGAACCACTCA 58.943 55.000 0.0 0.00 0.00 3.41
3132 3933 4.502259 CGGCCTGAGCTATTATCAGAACTT 60.502 45.833 0.0 0.00 45.80 2.66
3669 4471 1.808945 GATCACACAACTGCCTTCCTG 59.191 52.381 0.0 0.00 0.00 3.86
3918 4720 8.768955 GGCTAAGTCAGTCATTATCAATGTTAG 58.231 37.037 0.0 1.28 39.87 2.34
3926 4728 4.273235 TCATTATCAATGTTAGTGCTGCGG 59.727 41.667 0.0 0.00 39.87 5.69
3930 4732 3.605634 TCAATGTTAGTGCTGCGGTATT 58.394 40.909 0.0 0.00 0.00 1.89
3934 4736 1.091537 TTAGTGCTGCGGTATTTGCC 58.908 50.000 0.0 0.00 0.00 4.52
3935 4737 0.746563 TAGTGCTGCGGTATTTGCCC 60.747 55.000 0.0 0.00 0.00 5.36
3936 4738 2.034843 TGCTGCGGTATTTGCCCA 59.965 55.556 0.0 0.00 0.00 5.36
3937 4739 1.604879 TGCTGCGGTATTTGCCCAA 60.605 52.632 0.0 0.00 0.00 4.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
586 590 7.115414 CCTACTTTCATTTTCTCTTGGAGGAT 58.885 38.462 0.00 0.00 0.00 3.24
3132 3933 7.739911 CGAATTTAACGATCGATTGCATTCATA 59.260 33.333 24.34 0.00 38.82 2.15
3669 4471 2.086054 AGACTGAAACGATCACCTGC 57.914 50.000 0.00 0.00 33.47 4.85
3846 4648 0.867753 CGCTAGTGCTCACGCCTAAG 60.868 60.000 0.00 0.00 36.97 2.18
3887 4689 2.202756 GACTGACTTAGCCGGCGG 60.203 66.667 24.35 24.35 0.00 6.13
3918 4720 1.872197 TTGGGCAAATACCGCAGCAC 61.872 55.000 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.