Multiple sequence alignment - TraesCS7A01G542400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G542400 chr7A 100.000 2357 0 0 1 2357 719272601 719270245 0.000000e+00 4353.0
1 TraesCS7A01G542400 chr7A 98.813 2358 24 3 1 2357 719038389 719036035 0.000000e+00 4196.0
2 TraesCS7A01G542400 chr7A 98.770 2358 26 2 1 2357 718998732 718996377 0.000000e+00 4191.0
3 TraesCS7A01G542400 chr7A 96.444 956 28 2 1 952 719326058 719325105 0.000000e+00 1572.0
4 TraesCS7A01G542400 chr7A 93.993 899 26 6 941 1822 719314223 719313336 0.000000e+00 1336.0
5 TraesCS7A01G542400 chr7A 95.592 363 15 1 1987 2348 719313236 719312874 4.370000e-162 580.0
6 TraesCS7A01G542400 chr7A 80.479 292 45 5 923 1203 718271326 718271036 1.830000e-51 213.0
7 TraesCS7A01G542400 chr7A 100.000 81 0 0 1869 1949 719313323 719313243 1.460000e-32 150.0
8 TraesCS7A01G542400 chr7A 80.374 107 13 6 1712 1815 721201492 721201593 9.030000e-10 75.0
9 TraesCS7A01G542400 chr7D 80.665 481 87 5 924 1400 622993394 622993872 3.700000e-98 368.0
10 TraesCS7A01G542400 chr7D 77.811 338 66 6 1091 1423 623359332 623359665 1.430000e-47 200.0
11 TraesCS7A01G542400 chr7D 87.037 54 7 0 607 660 597085462 597085515 7.030000e-06 62.1
12 TraesCS7A01G542400 chr7B 81.702 470 57 16 1239 1703 720843520 720843075 4.790000e-97 364.0
13 TraesCS7A01G542400 chr7B 81.489 470 58 16 1239 1703 720887782 720887337 2.230000e-95 359.0
14 TraesCS7A01G542400 chr7B 81.404 285 44 6 927 1203 720888071 720887788 8.480000e-55 224.0
15 TraesCS7A01G542400 chr7B 81.053 285 45 6 927 1203 720843809 720843526 3.940000e-53 219.0
16 TraesCS7A01G542400 chr6A 85.088 114 15 1 1702 1815 495740876 495740765 5.320000e-22 115.0
17 TraesCS7A01G542400 chr4D 84.404 109 15 2 1938 2045 63255490 63255597 3.200000e-19 106.0
18 TraesCS7A01G542400 chr6D 86.139 101 8 3 1702 1797 347547189 347547288 1.150000e-18 104.0
19 TraesCS7A01G542400 chr5D 90.000 70 6 1 1709 1778 253199416 253199348 3.230000e-14 89.8
20 TraesCS7A01G542400 chr5B 86.842 76 10 0 1722 1797 292013780 292013855 4.170000e-13 86.1
21 TraesCS7A01G542400 chr5B 74.419 172 33 5 493 654 687263926 687263756 1.960000e-06 63.9
22 TraesCS7A01G542400 chr3A 82.243 107 10 5 1940 2046 25849985 25850082 1.500000e-12 84.2
23 TraesCS7A01G542400 chr3B 78.571 112 22 1 1703 1814 17985871 17985980 3.250000e-09 73.1
24 TraesCS7A01G542400 chr4B 87.931 58 7 0 626 683 386227103 386227160 4.200000e-08 69.4
25 TraesCS7A01G542400 chr4A 87.931 58 7 0 626 683 165707422 165707365 4.200000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G542400 chr7A 719270245 719272601 2356 True 4353.000000 4353 100.000000 1 2357 1 chr7A.!!$R4 2356
1 TraesCS7A01G542400 chr7A 719036035 719038389 2354 True 4196.000000 4196 98.813000 1 2357 1 chr7A.!!$R3 2356
2 TraesCS7A01G542400 chr7A 718996377 718998732 2355 True 4191.000000 4191 98.770000 1 2357 1 chr7A.!!$R2 2356
3 TraesCS7A01G542400 chr7A 719325105 719326058 953 True 1572.000000 1572 96.444000 1 952 1 chr7A.!!$R5 951
4 TraesCS7A01G542400 chr7A 719312874 719314223 1349 True 688.666667 1336 96.528333 941 2348 3 chr7A.!!$R6 1407
5 TraesCS7A01G542400 chr7B 720843075 720843809 734 True 291.500000 364 81.377500 927 1703 2 chr7B.!!$R1 776
6 TraesCS7A01G542400 chr7B 720887337 720888071 734 True 291.500000 359 81.446500 927 1703 2 chr7B.!!$R2 776

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
242 243 3.153369 AGATGCACACAACCAATACCA 57.847 42.857 0.0 0.0 0.0 3.25 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1402 1422 1.947456 CCTAGCACCGGAAATAAAGGC 59.053 52.381 9.46 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 3.512516 GCCCATGCTCAAGCGGAC 61.513 66.667 0.00 0.0 45.83 4.79
241 242 5.835113 ATAAGATGCACACAACCAATACC 57.165 39.130 0.00 0.0 0.00 2.73
242 243 3.153369 AGATGCACACAACCAATACCA 57.847 42.857 0.00 0.0 0.00 3.25
560 561 7.986889 ACTTCAACAAGGTAAAGATGCAAAAAT 59.013 29.630 0.00 0.0 33.37 1.82
967 972 8.792830 TCAAGATTTGGATCAACTTAACTAGG 57.207 34.615 0.00 0.0 34.60 3.02
1077 1089 3.702555 GCTGTGTGCGTGACGACC 61.703 66.667 10.10 0.0 0.00 4.79
1402 1422 1.473434 GCCAGTATCCTTGGTCCGAAG 60.473 57.143 0.00 0.0 38.02 3.79
1578 1607 7.064134 ACACTAAATTTCGCAATTCGTCAGATA 59.936 33.333 0.00 0.0 39.67 1.98
2108 2139 6.535963 AATTTGAAATCTCAATGAGGTCCC 57.464 37.500 10.71 0.0 41.22 4.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 8.220755 TCCTTATTATCGAAAAAGGGTTGATG 57.779 34.615 14.67 0.0 39.21 3.07
167 168 5.879223 TGTGTGTGTATGTCAATGATGCATA 59.121 36.000 0.00 0.0 0.00 3.14
241 242 1.355005 TCTTCGTGTGTGTGTGTGTG 58.645 50.000 0.00 0.0 0.00 3.82
242 243 2.087501 TTCTTCGTGTGTGTGTGTGT 57.912 45.000 0.00 0.0 0.00 3.72
354 355 1.417145 TGGGTGGCGTAGTTGTACTTT 59.583 47.619 0.00 0.0 0.00 2.66
967 972 9.283420 CGTATATGACTGAATGTATGAGATGAC 57.717 37.037 0.00 0.0 0.00 3.06
1402 1422 1.947456 CCTAGCACCGGAAATAAAGGC 59.053 52.381 9.46 0.0 0.00 4.35
1578 1607 3.073798 TCATTACCCGCCATGGTCATATT 59.926 43.478 14.67 0.0 39.91 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.