Multiple sequence alignment - TraesCS7A01G542300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G542300 chr7A 100.000 2357 0 0 1 2357 719038391 719036035 0.000000e+00 4353.0
1 TraesCS7A01G542300 chr7A 98.814 2360 24 3 1 2357 719272603 719270245 0.000000e+00 4200.0
2 TraesCS7A01G542300 chr7A 98.685 2358 30 1 1 2357 718998734 718996377 0.000000e+00 4181.0
3 TraesCS7A01G542300 chr7A 96.548 956 29 1 1 952 719326060 719325105 0.000000e+00 1580.0
4 TraesCS7A01G542300 chr7A 93.771 899 27 7 941 1821 719314223 719313336 0.000000e+00 1323.0
5 TraesCS7A01G542300 chr7A 94.780 364 17 2 1986 2348 719313236 719312874 1.220000e-157 566.0
6 TraesCS7A01G542300 chr7A 100.000 81 0 0 1868 1948 719313323 719313243 1.460000e-32 150.0
7 TraesCS7A01G542300 chr7A 86.275 102 12 2 1096 1196 718294692 718294592 2.480000e-20 110.0
8 TraesCS7A01G542300 chr7A 84.466 103 14 2 1095 1196 718310946 718310845 1.490000e-17 100.0
9 TraesCS7A01G542300 chr7A 84.314 102 14 2 1096 1196 718288403 718288303 5.360000e-17 99.0
10 TraesCS7A01G542300 chr7A 80.374 107 13 6 1711 1814 721201492 721201593 9.030000e-10 75.0
11 TraesCS7A01G542300 chr7B 77.792 788 110 35 927 1702 720843809 720843075 2.170000e-115 425.0
12 TraesCS7A01G542300 chr7B 77.792 788 110 35 927 1702 720888071 720887337 2.170000e-115 425.0
13 TraesCS7A01G542300 chr7D 80.665 481 87 6 924 1400 622993394 622993872 3.700000e-98 368.0
14 TraesCS7A01G542300 chr7D 78.338 337 66 4 1091 1423 623359332 623359665 6.600000e-51 211.0
15 TraesCS7A01G542300 chr7D 87.379 103 11 2 1095 1196 623342659 623342760 1.480000e-22 117.0
16 TraesCS7A01G542300 chr7D 87.037 54 7 0 607 660 597085462 597085515 7.030000e-06 62.1
17 TraesCS7A01G542300 chr6A 85.088 114 15 1 1701 1814 495740876 495740765 5.320000e-22 115.0
18 TraesCS7A01G542300 chr4D 84.404 109 15 2 1937 2044 63255490 63255597 3.200000e-19 106.0
19 TraesCS7A01G542300 chr6D 86.139 101 8 3 1701 1796 347547189 347547288 1.150000e-18 104.0
20 TraesCS7A01G542300 chr5D 90.000 70 6 1 1708 1777 253199416 253199348 3.230000e-14 89.8
21 TraesCS7A01G542300 chr5B 86.842 76 10 0 1721 1796 292013780 292013855 4.170000e-13 86.1
22 TraesCS7A01G542300 chr5B 74.419 172 33 5 493 654 687263926 687263756 1.960000e-06 63.9
23 TraesCS7A01G542300 chr3A 81.308 107 11 5 1939 2045 25849985 25850082 6.980000e-11 78.7
24 TraesCS7A01G542300 chr3B 78.571 112 22 1 1702 1813 17985871 17985980 3.250000e-09 73.1
25 TraesCS7A01G542300 chr4B 87.931 58 7 0 626 683 386227103 386227160 4.200000e-08 69.4
26 TraesCS7A01G542300 chr4A 87.931 58 7 0 626 683 165707422 165707365 4.200000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G542300 chr7A 719036035 719038391 2356 True 4353.000000 4353 100.000000 1 2357 1 chr7A.!!$R5 2356
1 TraesCS7A01G542300 chr7A 719270245 719272603 2358 True 4200.000000 4200 98.814000 1 2357 1 chr7A.!!$R6 2356
2 TraesCS7A01G542300 chr7A 718996377 718998734 2357 True 4181.000000 4181 98.685000 1 2357 1 chr7A.!!$R4 2356
3 TraesCS7A01G542300 chr7A 719325105 719326060 955 True 1580.000000 1580 96.548000 1 952 1 chr7A.!!$R7 951
4 TraesCS7A01G542300 chr7A 719312874 719314223 1349 True 679.666667 1323 96.183667 941 2348 3 chr7A.!!$R8 1407
5 TraesCS7A01G542300 chr7B 720843075 720843809 734 True 425.000000 425 77.792000 927 1702 1 chr7B.!!$R1 775
6 TraesCS7A01G542300 chr7B 720887337 720888071 734 True 425.000000 425 77.792000 927 1702 1 chr7B.!!$R2 775

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
772 775 1.148759 GAGAAATCGTCTCCAGCCGC 61.149 60.0 0.0 0.0 46.32 6.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2329 2365 2.801077 AATAAAAGTGGACGGGGGAG 57.199 50.0 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
295 298 5.392767 AAGAGCAAAGTCGTAGAAGATCA 57.607 39.130 0.00 0.0 39.69 2.92
311 314 7.676683 AGAAGATCAAAGTTATACCTAGGCA 57.323 36.000 9.30 0.0 0.00 4.75
564 567 7.341445 ACAAGGTAAAGATGCAAAAACACTA 57.659 32.000 0.00 0.0 0.00 2.74
772 775 1.148759 GAGAAATCGTCTCCAGCCGC 61.149 60.000 0.00 0.0 46.32 6.53
990 1004 7.604549 AGCTCATCTCATACATTCAGTCATAG 58.395 38.462 0.00 0.0 0.00 2.23
1404 1426 1.137697 AGTTTCCTTGGTCCGAACCT 58.862 50.000 0.00 0.0 46.60 3.50
1999 2033 3.698250 TTCAGTGGGGTCTGAAACG 57.302 52.632 6.66 0.0 46.88 3.60
2173 2207 3.089284 TCTCCGAGAGTGAGTTGCAATA 58.911 45.455 0.59 0.0 32.49 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
295 298 4.288887 GCCCCTATGCCTAGGTATAACTTT 59.711 45.833 18.85 0.0 42.78 2.66
488 491 5.006386 GTGATCTTCAGGGTGAAAACTCAT 58.994 41.667 0.00 0.0 35.73 2.90
772 775 0.538118 TCGGTCCCCATTTAAGTCGG 59.462 55.000 0.00 0.0 0.00 4.79
990 1004 5.348986 TCTACTTGCTCCATTGTTATCGTC 58.651 41.667 0.00 0.0 0.00 4.20
1404 1426 4.183101 CGTACCTAGCACCGGAAATAAAA 58.817 43.478 9.46 0.0 0.00 1.52
2173 2207 8.885693 AGCTCCTTTCTTTTAAATATCTTGGT 57.114 30.769 0.00 0.0 0.00 3.67
2329 2365 2.801077 AATAAAAGTGGACGGGGGAG 57.199 50.000 0.00 0.0 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.