Multiple sequence alignment - TraesCS7A01G539700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G539700 chr7A 100.000 3123 0 0 1 3123 716609217 716606095 0.000000e+00 5768.0
1 TraesCS7A01G539700 chr7A 98.097 2732 33 7 395 3123 716502933 716505648 0.000000e+00 4739.0
2 TraesCS7A01G539700 chr7A 96.535 404 14 0 1 404 716502173 716502576 0.000000e+00 669.0
3 TraesCS7A01G539700 chr7A 74.378 964 165 63 1856 2786 697825528 697826442 1.390000e-88 337.0
4 TraesCS7A01G539700 chr7D 95.086 2747 101 21 395 3123 621314817 621312087 0.000000e+00 4294.0
5 TraesCS7A01G539700 chr7D 96.543 405 13 1 1 404 621315582 621315178 0.000000e+00 669.0
6 TraesCS7A01G539700 chr7D 73.948 1259 210 80 1811 3022 606303654 606304841 1.740000e-107 399.0
7 TraesCS7A01G539700 chr7D 74.158 1010 172 70 1856 2826 606108884 606109843 1.390000e-88 337.0
8 TraesCS7A01G539700 chr7D 92.405 79 6 0 326 404 622089106 622089184 2.550000e-21 113.0
9 TraesCS7A01G539700 chr7B 92.893 2758 127 22 395 3123 718572963 718575680 0.000000e+00 3943.0
10 TraesCS7A01G539700 chr7B 92.915 2724 124 22 395 3089 718596453 718599136 0.000000e+00 3897.0
11 TraesCS7A01G539700 chr7B 96.742 399 10 3 2727 3123 718508683 718509080 0.000000e+00 662.0
12 TraesCS7A01G539700 chr7B 93.069 404 11 2 1 404 718595706 718596092 2.700000e-160 575.0
13 TraesCS7A01G539700 chr7B 92.822 404 12 2 1 404 718572216 718572602 1.260000e-158 569.0
14 TraesCS7A01G539700 chr7B 81.561 602 86 12 767 1346 719804636 719805234 1.010000e-129 473.0
15 TraesCS7A01G539700 chr7B 81.395 602 87 12 767 1346 719842702 719843300 4.720000e-128 468.0
16 TraesCS7A01G539700 chr7B 74.215 1051 193 61 1811 2826 690032349 690033356 4.920000e-98 368.0
17 TraesCS7A01G539700 chr7B 87.365 277 26 5 1 272 719804092 719804364 3.020000e-80 309.0
18 TraesCS7A01G539700 chr7B 89.474 247 21 5 395 638 718510551 718510795 1.090000e-79 307.0
19 TraesCS7A01G539700 chr7B 89.474 247 21 5 395 638 718577150 718577394 1.090000e-79 307.0
20 TraesCS7A01G539700 chr7B 87.288 236 27 2 1 236 718903542 718903774 1.850000e-67 267.0
21 TraesCS7A01G539700 chr7B 86.636 217 23 6 679 894 719869305 719869516 5.210000e-58 235.0
22 TraesCS7A01G539700 chr7B 94.595 74 4 0 326 399 719869039 719869112 7.080000e-22 115.0
23 TraesCS7A01G539700 chr7B 92.405 79 5 1 327 404 719804373 719804451 9.160000e-21 111.0
24 TraesCS7A01G539700 chr7B 91.549 71 4 2 1277 1346 719872251 719872320 2.560000e-16 97.1
25 TraesCS7A01G539700 chrUn 92.981 1795 76 15 395 2178 329801760 329800005 0.000000e+00 2571.0
26 TraesCS7A01G539700 chrUn 95.351 1183 42 5 1006 2178 429197404 429198583 0.000000e+00 1868.0
27 TraesCS7A01G539700 chrUn 88.462 598 32 8 395 991 384893335 384892774 0.000000e+00 688.0
28 TraesCS7A01G539700 chrUn 96.742 399 10 3 2727 3123 270666414 270666811 0.000000e+00 662.0
29 TraesCS7A01G539700 chrUn 96.742 399 10 3 2727 3123 293895833 293896230 0.000000e+00 662.0
30 TraesCS7A01G539700 chrUn 93.069 404 11 2 1 404 329802507 329802121 2.700000e-160 575.0
31 TraesCS7A01G539700 chrUn 93.069 404 11 2 1 404 384894082 384893696 2.700000e-160 575.0
32 TraesCS7A01G539700 chrUn 74.638 1104 227 35 2014 3104 33121126 33122189 3.700000e-119 438.0
33 TraesCS7A01G539700 chrUn 89.474 247 21 5 395 638 293897701 293897945 1.090000e-79 307.0
34 TraesCS7A01G539700 chr5D 88.017 484 45 9 679 1157 459578439 459578914 7.560000e-156 560.0
35 TraesCS7A01G539700 chr5B 86.008 486 51 9 679 1159 563716746 563717219 3.590000e-139 505.0
36 TraesCS7A01G539700 chr5B 85.802 486 52 9 679 1159 563736820 563737293 1.670000e-137 499.0
37 TraesCS7A01G539700 chr5B 84.774 486 58 7 679 1159 563752139 563752613 1.010000e-129 473.0
38 TraesCS7A01G539700 chr5B 85.209 311 31 11 679 984 563684032 563684332 3.910000e-79 305.0
39 TraesCS7A01G539700 chr3A 74.615 1103 230 33 2014 3104 704579253 704580317 1.030000e-119 440.0
40 TraesCS7A01G539700 chr3A 74.141 1106 229 42 2014 3102 704778819 704777754 3.750000e-109 405.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G539700 chr7A 716606095 716609217 3122 True 5768.000000 5768 100.000000 1 3123 1 chr7A.!!$R1 3122
1 TraesCS7A01G539700 chr7A 716502173 716505648 3475 False 2704.000000 4739 97.316000 1 3123 2 chr7A.!!$F2 3122
2 TraesCS7A01G539700 chr7A 697825528 697826442 914 False 337.000000 337 74.378000 1856 2786 1 chr7A.!!$F1 930
3 TraesCS7A01G539700 chr7D 621312087 621315582 3495 True 2481.500000 4294 95.814500 1 3123 2 chr7D.!!$R1 3122
4 TraesCS7A01G539700 chr7D 606303654 606304841 1187 False 399.000000 399 73.948000 1811 3022 1 chr7D.!!$F2 1211
5 TraesCS7A01G539700 chr7D 606108884 606109843 959 False 337.000000 337 74.158000 1856 2826 1 chr7D.!!$F1 970
6 TraesCS7A01G539700 chr7B 718595706 718599136 3430 False 2236.000000 3897 92.992000 1 3089 2 chr7B.!!$F6 3088
7 TraesCS7A01G539700 chr7B 718572216 718577394 5178 False 1606.333333 3943 91.729667 1 3123 3 chr7B.!!$F5 3122
8 TraesCS7A01G539700 chr7B 718508683 718510795 2112 False 484.500000 662 93.108000 395 3123 2 chr7B.!!$F4 2728
9 TraesCS7A01G539700 chr7B 719842702 719843300 598 False 468.000000 468 81.395000 767 1346 1 chr7B.!!$F3 579
10 TraesCS7A01G539700 chr7B 690032349 690033356 1007 False 368.000000 368 74.215000 1811 2826 1 chr7B.!!$F1 1015
11 TraesCS7A01G539700 chr7B 719804092 719805234 1142 False 297.666667 473 87.110333 1 1346 3 chr7B.!!$F7 1345
12 TraesCS7A01G539700 chrUn 429197404 429198583 1179 False 1868.000000 1868 95.351000 1006 2178 1 chrUn.!!$F3 1172
13 TraesCS7A01G539700 chrUn 329800005 329802507 2502 True 1573.000000 2571 93.025000 1 2178 2 chrUn.!!$R1 2177
14 TraesCS7A01G539700 chrUn 384892774 384894082 1308 True 631.500000 688 90.765500 1 991 2 chrUn.!!$R2 990
15 TraesCS7A01G539700 chrUn 293895833 293897945 2112 False 484.500000 662 93.108000 395 3123 2 chrUn.!!$F4 2728
16 TraesCS7A01G539700 chrUn 33121126 33122189 1063 False 438.000000 438 74.638000 2014 3104 1 chrUn.!!$F1 1090
17 TraesCS7A01G539700 chr3A 704579253 704580317 1064 False 440.000000 440 74.615000 2014 3104 1 chr3A.!!$F1 1090
18 TraesCS7A01G539700 chr3A 704777754 704778819 1065 True 405.000000 405 74.141000 2014 3102 1 chr3A.!!$R1 1088

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
662 1043 1.565759 CTCCCCATCTCCATTCAACCA 59.434 52.381 0.0 0.0 0.00 3.67 F
1381 1820 0.249657 GAGATGGATCTGCCCGTCAC 60.250 60.000 0.0 0.0 43.15 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2101 2559 3.485394 TCACAGCCTTCTTGTTGCAATA 58.515 40.909 0.59 0.0 0.00 1.90 R
3058 3612 3.565902 TGTTCATGGTTACGCATGAAACA 59.434 39.130 21.63 18.9 45.67 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
104 109 2.045926 GTGCCAGGCCACGAAGAT 60.046 61.111 9.64 0.00 0.00 2.40
158 163 6.248433 ACAAAAATAGGAAGCTTCATGGAGA 58.752 36.000 27.02 6.27 0.00 3.71
362 369 6.976636 TCAATCACAAGTATACGAATGCAA 57.023 33.333 0.00 0.00 0.00 4.08
399 406 4.287720 CGGTCAAAGCAAGTAAAAAGACC 58.712 43.478 0.00 0.00 40.57 3.85
464 844 3.249080 TCGGGAGAAAACATCAAAACGAC 59.751 43.478 0.00 0.00 34.75 4.34
473 853 5.514274 AACATCAAAACGACAACCAAGAT 57.486 34.783 0.00 0.00 0.00 2.40
662 1043 1.565759 CTCCCCATCTCCATTCAACCA 59.434 52.381 0.00 0.00 0.00 3.67
814 1195 3.517100 CTGGTCCTTCTCCTCTCAAATCA 59.483 47.826 0.00 0.00 0.00 2.57
816 1197 4.350816 TGGTCCTTCTCCTCTCAAATCAAA 59.649 41.667 0.00 0.00 0.00 2.69
1381 1820 0.249657 GAGATGGATCTGCCCGTCAC 60.250 60.000 0.00 0.00 43.15 3.67
1382 1821 0.977627 AGATGGATCTGCCCGTCACA 60.978 55.000 0.00 0.00 43.15 3.58
1412 1851 4.632153 TCTCACTGCTCAACTTAAAGTCC 58.368 43.478 0.00 0.00 0.00 3.85
1914 2360 9.643693 CTTTCAAACACCAAATTTATCATAGCT 57.356 29.630 0.00 0.00 0.00 3.32
2101 2559 2.027837 TGTCATGCAGTGCTATCTGTGT 60.028 45.455 17.60 0.00 37.70 3.72
2231 2689 6.771267 TGAAAGGAGGAGAAATGATGATGATG 59.229 38.462 0.00 0.00 0.00 3.07
2233 2691 6.705664 AGGAGGAGAAATGATGATGATGAT 57.294 37.500 0.00 0.00 0.00 2.45
2234 2692 6.477253 AGGAGGAGAAATGATGATGATGATG 58.523 40.000 0.00 0.00 0.00 3.07
2235 2693 6.272558 AGGAGGAGAAATGATGATGATGATGA 59.727 38.462 0.00 0.00 0.00 2.92
2236 2694 7.037225 AGGAGGAGAAATGATGATGATGATGAT 60.037 37.037 0.00 0.00 0.00 2.45
2346 2816 7.993183 TGAAGGATATGATTCTAACAAGAACCC 59.007 37.037 0.00 0.00 0.00 4.11
2589 3064 3.973206 ATGAACGTGGATTACCTCACA 57.027 42.857 0.00 0.00 37.04 3.58
3057 3611 2.430332 CAACAACATGAACAACCAGGGT 59.570 45.455 0.00 0.00 0.00 4.34
3058 3612 2.745968 ACAACATGAACAACCAGGGTT 58.254 42.857 0.00 0.00 39.13 4.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
301 308 6.959606 ATGTGGAGGCCTAAACTCATATAT 57.040 37.500 4.42 0.0 36.70 0.86
362 369 3.330720 CCGGGCAAGGAGAGGGTT 61.331 66.667 0.00 0.0 0.00 4.11
473 853 2.016604 GCATATCTGTTCGTGGGCCAA 61.017 52.381 8.40 0.0 0.00 4.52
634 1015 1.230497 GAGATGGGGAGACGGGAGA 59.770 63.158 0.00 0.0 0.00 3.71
635 1016 1.834822 GGAGATGGGGAGACGGGAG 60.835 68.421 0.00 0.0 0.00 4.30
637 1018 1.056700 AATGGAGATGGGGAGACGGG 61.057 60.000 0.00 0.0 0.00 5.28
638 1019 0.394565 GAATGGAGATGGGGAGACGG 59.605 60.000 0.00 0.0 0.00 4.79
639 1020 1.123077 TGAATGGAGATGGGGAGACG 58.877 55.000 0.00 0.0 0.00 4.18
814 1195 5.733373 GCGACAGGAAGAACAGAACAATTTT 60.733 40.000 0.00 0.0 0.00 1.82
816 1197 3.251004 GCGACAGGAAGAACAGAACAATT 59.749 43.478 0.00 0.0 0.00 2.32
1381 1820 4.082300 AGTTGAGCAGTGAGAGTACTGATG 60.082 45.833 0.00 0.0 46.31 3.07
1994 2444 6.777782 TGTTTTCCCCAATGCTTAAATGAAT 58.222 32.000 0.00 0.0 0.00 2.57
2101 2559 3.485394 TCACAGCCTTCTTGTTGCAATA 58.515 40.909 0.59 0.0 0.00 1.90
2231 2689 8.668510 TCATCATCATCATCATCATCATCATC 57.331 34.615 0.00 0.0 0.00 2.92
2233 2691 8.267183 TCATCATCATCATCATCATCATCATCA 58.733 33.333 0.00 0.0 0.00 3.07
2234 2692 8.668510 TCATCATCATCATCATCATCATCATC 57.331 34.615 0.00 0.0 0.00 2.92
2235 2693 9.064706 CATCATCATCATCATCATCATCATCAT 57.935 33.333 0.00 0.0 0.00 2.45
2236 2694 8.267183 TCATCATCATCATCATCATCATCATCA 58.733 33.333 0.00 0.0 0.00 3.07
2346 2816 4.141869 TGGTGGATATGTGTGTGATCTCTG 60.142 45.833 0.00 0.0 0.00 3.35
2589 3064 4.887071 AGATGACTTGCGATACTCTCTCTT 59.113 41.667 0.00 0.0 0.00 2.85
3057 3611 4.036852 TGTTCATGGTTACGCATGAAACAA 59.963 37.500 21.63 12.9 45.67 2.83
3058 3612 3.565902 TGTTCATGGTTACGCATGAAACA 59.434 39.130 21.63 18.9 45.67 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.