Multiple sequence alignment - TraesCS7A01G538300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G538300 chr7A 100.000 2513 0 0 1 2513 715578717 715576205 0.000000e+00 4641
1 TraesCS7A01G538300 chr7A 97.836 1895 38 2 121 2012 715246798 715244904 0.000000e+00 3269
2 TraesCS7A01G538300 chr7A 98.185 1818 30 2 1 1818 715437348 715435534 0.000000e+00 3171
3 TraesCS7A01G538300 chr7A 98.756 1527 19 0 987 2513 715662730 715661204 0.000000e+00 2715
4 TraesCS7A01G538300 chr7A 98.776 899 10 1 1 899 715334683 715333786 0.000000e+00 1598
5 TraesCS7A01G538300 chr7A 98.434 894 14 0 986 1879 715333786 715332893 0.000000e+00 1574
6 TraesCS7A01G538300 chr7A 97.405 501 13 0 2013 2513 715422627 715422127 0.000000e+00 854
7 TraesCS7A01G538300 chr7A 92.000 250 14 5 2266 2513 76575812 76576057 1.850000e-91 346
8 TraesCS7A01G538300 chr7A 95.939 197 4 2 1816 2012 715425505 715425313 1.450000e-82 316
9 TraesCS7A01G538300 chr7A 99.029 103 1 0 2194 2296 715242127 715242025 4.270000e-43 185
10 TraesCS7A01G538300 chr7A 92.222 90 6 1 2013 2102 715242213 715242125 2.620000e-25 126
11 TraesCS7A01G538300 chr7A 100.000 60 0 0 1816 1875 715329361 715329302 7.350000e-21 111
12 TraesCS7A01G538300 chr7B 91.134 1049 54 17 982 2012 716977322 716978349 0.000000e+00 1386
13 TraesCS7A01G538300 chr7B 90.296 845 36 18 987 1808 716699889 716699068 0.000000e+00 1064
14 TraesCS7A01G538300 chr7B 88.791 455 35 6 1573 2012 716984530 716984983 6.110000e-151 544
15 TraesCS7A01G538300 chr7B 90.909 187 13 3 1 184 587458282 587458097 5.370000e-62 248
16 TraesCS7A01G538300 chr7B 86.383 235 21 6 2061 2293 716988687 716988912 1.930000e-61 246
17 TraesCS7A01G538300 chr7B 92.308 169 13 0 1844 2012 716699070 716698902 8.980000e-60 241
18 TraesCS7A01G538300 chr3D 96.847 222 7 0 2292 2513 15749090 15748869 3.050000e-99 372
19 TraesCS7A01G538300 chr1D 96.847 222 6 1 2292 2513 414815060 414815280 1.100000e-98 370
20 TraesCS7A01G538300 chr6D 96.396 222 8 0 2292 2513 262034477 262034698 1.420000e-97 366
21 TraesCS7A01G538300 chr4A 95.259 232 8 3 2283 2513 40568249 40568478 5.110000e-97 364
22 TraesCS7A01G538300 chr4A 92.737 179 11 2 1 178 436061944 436061767 8.920000e-65 257
23 TraesCS7A01G538300 chr2D 95.946 222 7 2 2292 2513 184064511 184064292 2.380000e-95 359
24 TraesCS7A01G538300 chr2B 92.369 249 14 4 2267 2513 55237942 55237697 1.430000e-92 350
25 TraesCS7A01G538300 chr7D 88.112 286 27 4 2010 2293 619887480 619887760 1.440000e-87 333
26 TraesCS7A01G538300 chrUn 92.737 179 11 2 1 178 110541297 110541474 8.920000e-65 257
27 TraesCS7A01G538300 chr3B 91.803 183 13 2 1 182 758762663 758762844 1.150000e-63 254
28 TraesCS7A01G538300 chr5D 92.179 179 12 2 1 178 22963270 22963093 4.150000e-63 252
29 TraesCS7A01G538300 chr3A 92.179 179 12 2 1 178 552188595 552188772 4.150000e-63 252
30 TraesCS7A01G538300 chr5A 90.000 190 17 2 1 189 54281748 54281936 6.940000e-61 244


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G538300 chr7A 715576205 715578717 2512 True 4641.000000 4641 100.000000 1 2513 1 chr7A.!!$R2 2512
1 TraesCS7A01G538300 chr7A 715435534 715437348 1814 True 3171.000000 3171 98.185000 1 1818 1 chr7A.!!$R1 1817
2 TraesCS7A01G538300 chr7A 715661204 715662730 1526 True 2715.000000 2715 98.756000 987 2513 1 chr7A.!!$R3 1526
3 TraesCS7A01G538300 chr7A 715242025 715246798 4773 True 1193.333333 3269 96.362333 121 2296 3 chr7A.!!$R4 2175
4 TraesCS7A01G538300 chr7A 715329302 715334683 5381 True 1094.333333 1598 99.070000 1 1879 3 chr7A.!!$R5 1878
5 TraesCS7A01G538300 chr7A 715422127 715425505 3378 True 585.000000 854 96.672000 1816 2513 2 chr7A.!!$R6 697
6 TraesCS7A01G538300 chr7B 716977322 716978349 1027 False 1386.000000 1386 91.134000 982 2012 1 chr7B.!!$F1 1030
7 TraesCS7A01G538300 chr7B 716698902 716699889 987 True 652.500000 1064 91.302000 987 2012 2 chr7B.!!$R2 1025
8 TraesCS7A01G538300 chr7B 716984530 716988912 4382 False 395.000000 544 87.587000 1573 2293 2 chr7B.!!$F2 720

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
22 23 1.143889 TGTTGTTGGTACCATGGCTGA 59.856 47.619 17.17 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1691 1716 4.924305 AATGAAATGCACAGAACAGTGT 57.076 36.364 0.0 0.0 41.52 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 1.143889 TGTTGTTGGTACCATGGCTGA 59.856 47.619 17.17 0.00 0.00 4.26
23 24 2.235016 GTTGTTGGTACCATGGCTGAA 58.765 47.619 17.17 0.00 0.00 3.02
145 146 6.235231 TGTGTCTTGGTCTAAGAGAAGTTT 57.765 37.500 0.00 0.00 45.71 2.66
158 162 9.708092 TCTAAGAGAAGTTTTCTTTAGGCTAAC 57.292 33.333 13.36 0.00 40.87 2.34
661 665 5.952033 TGCATATACCGTATACGCATTACA 58.048 37.500 19.86 8.36 35.24 2.41
757 761 1.677552 CGGGTCACCCTGCTAGTTT 59.322 57.895 12.38 0.00 42.67 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
145 146 5.221087 CGTTTGGGTTTGTTAGCCTAAAGAA 60.221 40.000 0.00 0.0 45.03 2.52
158 162 0.179001 ACTCCCTCCGTTTGGGTTTG 60.179 55.000 0.00 0.0 44.84 2.93
992 996 1.676529 TCTCTGAACCCATCGATCGAC 59.323 52.381 22.06 7.1 0.00 4.20
1691 1716 4.924305 AATGAAATGCACAGAACAGTGT 57.076 36.364 0.00 0.0 41.52 3.55
1761 1791 5.399858 TCTAATATACGCGAGGCTCAATTC 58.600 41.667 15.93 0.0 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.