Multiple sequence alignment - TraesCS7A01G536100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G536100 chr7A 100.000 3624 0 0 1 3624 713648359 713651982 0.000000e+00 6693.0
1 TraesCS7A01G536100 chr7A 95.682 3242 104 15 1 3219 713403024 713406252 0.000000e+00 5179.0
2 TraesCS7A01G536100 chr7A 95.557 3241 109 16 1 3219 713331617 713334844 0.000000e+00 5155.0
3 TraesCS7A01G536100 chr7A 95.426 3236 112 18 1 3219 713467655 713470871 0.000000e+00 5123.0
4 TraesCS7A01G536100 chr7A 99.911 2242 2 0 1383 3624 713614746 713616987 0.000000e+00 4130.0
5 TraesCS7A01G536100 chr7A 94.082 2653 116 18 584 3219 713264293 713266921 0.000000e+00 3991.0
6 TraesCS7A01G536100 chr7A 93.140 1866 100 12 1369 3219 713554744 713556596 0.000000e+00 2712.0
7 TraesCS7A01G536100 chr7A 91.353 1434 96 12 1801 3219 713527456 713528876 0.000000e+00 1936.0
8 TraesCS7A01G536100 chr7A 98.639 955 5 3 1 947 713525414 713526368 0.000000e+00 1685.0
9 TraesCS7A01G536100 chr7A 85.000 240 21 7 258 491 713263717 713263947 2.810000e-56 230.0
10 TraesCS7A01G536100 chr7A 77.612 268 46 10 49 313 705298720 705298976 2.250000e-32 150.0
11 TraesCS7A01G536100 chr7A 77.660 188 31 10 179 359 128001403 128001220 1.780000e-18 104.0
12 TraesCS7A01G536100 chr7D 90.214 2759 155 54 546 3219 619199808 619202536 0.000000e+00 3493.0
13 TraesCS7A01G536100 chr7D 93.527 2271 90 24 587 2814 619230457 619232713 0.000000e+00 3326.0
14 TraesCS7A01G536100 chr7D 92.736 413 24 2 3216 3624 619202602 619203012 3.120000e-165 592.0
15 TraesCS7A01G536100 chr7D 88.205 390 31 5 129 509 619229969 619230352 5.520000e-123 451.0
16 TraesCS7A01G536100 chr7D 81.557 244 33 9 47 287 566040077 566040311 1.330000e-44 191.0
17 TraesCS7A01G536100 chr7D 76.978 139 29 3 220 356 439866619 439866482 3.880000e-10 76.8
18 TraesCS7A01G536100 chr7B 93.935 2028 98 17 1215 3219 714759008 714761033 0.000000e+00 3040.0
19 TraesCS7A01G536100 chr7B 90.395 2280 152 33 727 2973 714739299 714741544 0.000000e+00 2935.0
20 TraesCS7A01G536100 chr7B 93.462 413 19 2 3216 3624 714761134 714761542 1.110000e-169 606.0
21 TraesCS7A01G536100 chr7B 92.095 253 18 2 727 978 714758531 714758782 4.450000e-94 355.0
22 TraesCS7A01G536100 chr7B 78.884 502 58 25 35 506 714738397 714738880 2.740000e-76 296.0
23 TraesCS7A01G536100 chr2B 81.494 308 42 8 53 356 601432642 601432938 4.680000e-59 239.0
24 TraesCS7A01G536100 chr3B 80.707 311 46 9 53 359 744600363 744600063 2.810000e-56 230.0
25 TraesCS7A01G536100 chrUn 81.041 269 39 6 1174 1433 93249450 93249185 1.710000e-48 204.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G536100 chr7A 713648359 713651982 3623 False 6693.000000 6693 100.0000 1 3624 1 chr7A.!!$F7 3623
1 TraesCS7A01G536100 chr7A 713403024 713406252 3228 False 5179.000000 5179 95.6820 1 3219 1 chr7A.!!$F3 3218
2 TraesCS7A01G536100 chr7A 713331617 713334844 3227 False 5155.000000 5155 95.5570 1 3219 1 chr7A.!!$F2 3218
3 TraesCS7A01G536100 chr7A 713467655 713470871 3216 False 5123.000000 5123 95.4260 1 3219 1 chr7A.!!$F4 3218
4 TraesCS7A01G536100 chr7A 713614746 713616987 2241 False 4130.000000 4130 99.9110 1383 3624 1 chr7A.!!$F6 2241
5 TraesCS7A01G536100 chr7A 713554744 713556596 1852 False 2712.000000 2712 93.1400 1369 3219 1 chr7A.!!$F5 1850
6 TraesCS7A01G536100 chr7A 713263717 713266921 3204 False 2110.500000 3991 89.5410 258 3219 2 chr7A.!!$F8 2961
7 TraesCS7A01G536100 chr7A 713525414 713528876 3462 False 1810.500000 1936 94.9960 1 3219 2 chr7A.!!$F9 3218
8 TraesCS7A01G536100 chr7D 619199808 619203012 3204 False 2042.500000 3493 91.4750 546 3624 2 chr7D.!!$F2 3078
9 TraesCS7A01G536100 chr7D 619229969 619232713 2744 False 1888.500000 3326 90.8660 129 2814 2 chr7D.!!$F3 2685
10 TraesCS7A01G536100 chr7B 714738397 714741544 3147 False 1615.500000 2935 84.6395 35 2973 2 chr7B.!!$F1 2938
11 TraesCS7A01G536100 chr7B 714758531 714761542 3011 False 1333.666667 3040 93.1640 727 3624 3 chr7B.!!$F2 2897

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
396 428 1.001393 TCGGTCTCCAAAATGCCCC 60.001 57.895 0.0 0.0 0.00 5.80 F
1381 2079 0.976641 TGGATCTGCGACTCCTGTTT 59.023 50.000 0.0 0.0 32.47 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1381 2079 1.833606 TGGAAAGGCGTCCAGTTGA 59.166 52.632 8.67 0.0 42.97 3.18 R
3322 4348 7.373493 AGCTTGAAGTGAACAATATTTCCTTG 58.627 34.615 0.00 0.0 0.00 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
314 325 3.678056 TGTAGCTCGTGATTCAAGGTT 57.322 42.857 0.0 0.0 0.00 3.50
396 428 1.001393 TCGGTCTCCAAAATGCCCC 60.001 57.895 0.0 0.0 0.00 5.80
1381 2079 0.976641 TGGATCTGCGACTCCTGTTT 59.023 50.000 0.0 0.0 32.47 2.83
1852 2741 1.667154 CTCGTCTCCATCTCCGGCAA 61.667 60.000 0.0 0.0 0.00 4.52
3322 4348 3.530535 GAGAGAGATGCTTTCTGGGAAC 58.469 50.000 0.0 0.0 33.74 3.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1381 2079 1.833606 TGGAAAGGCGTCCAGTTGA 59.166 52.632 8.67 0.0 42.97 3.18
1852 2741 1.908619 TGGCACCAGTCATGTAGTCAT 59.091 47.619 0.00 0.0 34.21 3.06
3322 4348 7.373493 AGCTTGAAGTGAACAATATTTCCTTG 58.627 34.615 0.00 0.0 0.00 3.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.