Multiple sequence alignment - TraesCS7A01G535900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G535900 chr7A 100.000 3807 0 0 1 3807 713467634 713471440 0.000000e+00 7031.0
1 TraesCS7A01G535900 chr7A 98.927 3820 27 4 1 3807 713331596 713335414 0.000000e+00 6815.0
2 TraesCS7A01G535900 chr7A 98.901 3821 28 3 1 3807 713403003 713406823 0.000000e+00 6811.0
3 TraesCS7A01G535900 chr7A 97.976 3211 40 7 611 3807 713264293 713267492 0.000000e+00 5546.0
4 TraesCS7A01G535900 chr7A 95.456 3257 112 19 1 3238 713648338 713651577 0.000000e+00 5162.0
5 TraesCS7A01G535900 chr7A 98.927 2424 14 2 1396 3807 713554744 713557167 0.000000e+00 4322.0
6 TraesCS7A01G535900 chr7A 98.946 1992 9 2 1828 3807 713527456 713529447 0.000000e+00 3552.0
7 TraesCS7A01G535900 chr7A 92.803 1848 103 16 1410 3238 713614746 713616582 0.000000e+00 2649.0
8 TraesCS7A01G535900 chr7A 99.385 976 4 1 1 974 713525393 713526368 0.000000e+00 1768.0
9 TraesCS7A01G535900 chr7A 85.417 240 20 7 285 518 713263717 713263947 6.360000e-58 235.0
10 TraesCS7A01G535900 chr7A 76.190 273 47 12 70 340 705298720 705298976 1.110000e-25 128.0
11 TraesCS7A01G535900 chr7A 77.778 189 31 10 204 386 128001403 128001220 5.200000e-19 106.0
12 TraesCS7A01G535900 chr7D 88.772 2761 183 56 573 3238 619199808 619202536 0.000000e+00 3264.0
13 TraesCS7A01G535900 chr7D 92.433 2273 108 29 614 2837 619230457 619232714 0.000000e+00 3186.0
14 TraesCS7A01G535900 chr7D 88.071 394 30 3 150 536 619229969 619230352 5.800000e-123 451.0
15 TraesCS7A01G535900 chr7D 79.518 249 35 9 68 314 566040077 566040311 3.040000e-36 163.0
16 TraesCS7A01G535900 chr7D 77.143 140 27 5 247 383 439866619 439866482 4.080000e-10 76.8
17 TraesCS7A01G535900 chr7B 91.713 2160 137 22 1242 3368 714759008 714761158 0.000000e+00 2959.0
18 TraesCS7A01G535900 chr7B 89.714 2275 160 36 754 2989 714739299 714741538 0.000000e+00 2837.0
19 TraesCS7A01G535900 chr7B 91.304 253 20 2 754 1005 714758531 714758782 1.010000e-90 344.0
20 TraesCS7A01G535900 chr7B 78.656 506 58 24 56 533 714738397 714738880 1.340000e-74 291.0
21 TraesCS7A01G535900 chr7B 93.333 60 4 0 470 529 714758054 714758113 5.240000e-14 89.8
22 TraesCS7A01G535900 chr2B 80.769 312 43 7 74 383 601432642 601432938 1.060000e-55 228.0
23 TraesCS7A01G535900 chr3B 79.683 315 48 7 74 386 744600363 744600063 2.980000e-51 213.0
24 TraesCS7A01G535900 chr3B 93.023 43 2 1 389 430 260646539 260646581 1.140000e-05 62.1
25 TraesCS7A01G535900 chrUn 81.041 269 39 6 1201 1460 93249450 93249185 1.790000e-48 204.0
26 TraesCS7A01G535900 chr4B 72.903 310 49 21 74 381 89923670 89923394 1.470000e-09 75.0
27 TraesCS7A01G535900 chr6D 97.222 36 1 0 396 431 13965083 13965118 1.140000e-05 62.1
28 TraesCS7A01G535900 chr6B 93.023 43 2 1 389 430 124627378 124627336 1.140000e-05 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G535900 chr7A 713467634 713471440 3806 False 7031.000000 7031 100.000000 1 3807 1 chr7A.!!$F4 3806
1 TraesCS7A01G535900 chr7A 713331596 713335414 3818 False 6815.000000 6815 98.927000 1 3807 1 chr7A.!!$F2 3806
2 TraesCS7A01G535900 chr7A 713403003 713406823 3820 False 6811.000000 6811 98.901000 1 3807 1 chr7A.!!$F3 3806
3 TraesCS7A01G535900 chr7A 713648338 713651577 3239 False 5162.000000 5162 95.456000 1 3238 1 chr7A.!!$F7 3237
4 TraesCS7A01G535900 chr7A 713554744 713557167 2423 False 4322.000000 4322 98.927000 1396 3807 1 chr7A.!!$F5 2411
5 TraesCS7A01G535900 chr7A 713263717 713267492 3775 False 2890.500000 5546 91.696500 285 3807 2 chr7A.!!$F8 3522
6 TraesCS7A01G535900 chr7A 713525393 713529447 4054 False 2660.000000 3552 99.165500 1 3807 2 chr7A.!!$F9 3806
7 TraesCS7A01G535900 chr7A 713614746 713616582 1836 False 2649.000000 2649 92.803000 1410 3238 1 chr7A.!!$F6 1828
8 TraesCS7A01G535900 chr7D 619199808 619202536 2728 False 3264.000000 3264 88.772000 573 3238 1 chr7D.!!$F2 2665
9 TraesCS7A01G535900 chr7D 619229969 619232714 2745 False 1818.500000 3186 90.252000 150 2837 2 chr7D.!!$F3 2687
10 TraesCS7A01G535900 chr7B 714738397 714741538 3141 False 1564.000000 2837 84.185000 56 2989 2 chr7B.!!$F1 2933
11 TraesCS7A01G535900 chr7B 714758054 714761158 3104 False 1130.933333 2959 92.116667 470 3368 3 chr7B.!!$F2 2898

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1386 2078 4.415596 CCTATGGCTCCTATCTCAACTCT 58.584 47.826 0.0 0.0 0.0 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3048 3968 0.250467 GCCAGTGTGCCTCTTTCTCA 60.25 55.0 0.0 0.0 0.0 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1386 2078 4.415596 CCTATGGCTCCTATCTCAACTCT 58.584 47.826 0.00 0.00 0.00 3.24
1826 2568 4.147321 CGAGGCTACTTAATACTGGGGTA 58.853 47.826 0.00 0.00 0.00 3.69
3048 3968 4.216257 AGCTATGTTTGACGTTGCAAAGAT 59.784 37.500 19.51 14.20 42.28 2.40
3371 4291 4.855388 GCTGCAATGTGTAGATTTCAAGTG 59.145 41.667 0.00 0.00 31.36 3.16
3585 4505 1.578367 CATCGTGTGCGTGCATTCG 60.578 57.895 12.78 12.78 39.49 3.34
3612 4533 7.035612 CCAAGAACTTCTAGCAAAACAAGTTT 58.964 34.615 6.48 0.00 38.82 2.66
3767 4690 3.718815 CGCTAGTCAAGGAAGGGATAAC 58.281 50.000 0.00 0.00 0.00 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
188 189 1.930503 CACACACACACACACACGTAT 59.069 47.619 0.00 0.00 0.00 3.06
324 329 3.938963 TCAAATACCTTGAATCACGAGCC 59.061 43.478 0.00 0.00 41.21 4.70
974 1623 1.821216 CTAGATGGTTGTGGCCGTTT 58.179 50.000 0.00 0.00 0.00 3.60
975 1624 0.676782 GCTAGATGGTTGTGGCCGTT 60.677 55.000 0.00 0.00 0.00 4.44
1386 2078 1.378646 AGGAGTCGCAGATCCACGA 60.379 57.895 3.71 3.71 40.67 4.35
1826 2568 5.506982 GCTCTGAAGCTGTTGTTTTGAGATT 60.507 40.000 0.00 0.00 45.55 2.40
3048 3968 0.250467 GCCAGTGTGCCTCTTTCTCA 60.250 55.000 0.00 0.00 0.00 3.27
3371 4291 1.893137 CCCCCTTAACTTGCTTCCAAC 59.107 52.381 0.00 0.00 0.00 3.77
3394 4314 3.095912 TGTTCCCCGAAGACATCTCTA 57.904 47.619 0.00 0.00 0.00 2.43
3585 4505 5.751243 TGTTTTGCTAGAAGTTCTTGGTC 57.249 39.130 11.40 0.00 0.00 4.02
3767 4690 7.201530 GGAAATACCGTCATCAACTCTGTAAAG 60.202 40.741 0.00 0.00 0.00 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.