Multiple sequence alignment - TraesCS7A01G535800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G535800 chr7A 100.000 3630 0 0 1 3630 713403032 713406661 0.000000e+00 6704.0
1 TraesCS7A01G535800 chr7A 99.339 3631 20 3 1 3630 713331625 713335252 0.000000e+00 6569.0
2 TraesCS7A01G535800 chr7A 98.981 3630 25 2 1 3630 713467663 713471280 0.000000e+00 6488.0
3 TraesCS7A01G535800 chr7A 98.557 3049 31 5 584 3630 713264293 713267330 0.000000e+00 5374.0
4 TraesCS7A01G535800 chr7A 95.671 3234 104 16 1 3221 713648367 713651577 0.000000e+00 5164.0
5 TraesCS7A01G535800 chr7A 99.381 2262 14 0 1369 3630 713554744 713557005 0.000000e+00 4100.0
6 TraesCS7A01G535800 chr7A 99.399 1830 11 0 1801 3630 713527456 713529285 0.000000e+00 3319.0
7 TraesCS7A01G535800 chr7A 93.197 1852 98 13 1383 3221 713614746 713616582 0.000000e+00 2697.0
8 TraesCS7A01G535800 chr7A 99.683 947 3 0 1 947 713525422 713526368 0.000000e+00 1733.0
9 TraesCS7A01G535800 chr7A 85.833 240 19 7 258 491 713263717 713263947 1.300000e-59 241.0
10 TraesCS7A01G535800 chr7A 76.277 274 47 13 41 313 705298720 705298976 2.940000e-26 130.0
11 TraesCS7A01G535800 chr7A 78.191 188 32 8 177 359 128001403 128001220 1.070000e-20 111.0
12 TraesCS7A01G535800 chr7D 89.050 2767 174 53 546 3221 619199808 619202536 0.000000e+00 3312.0
13 TraesCS7A01G535800 chr7D 92.669 2278 103 25 587 2820 619230457 619232714 0.000000e+00 3223.0
14 TraesCS7A01G535800 chr7D 88.131 396 28 3 121 509 619229969 619230352 1.540000e-123 453.0
15 TraesCS7A01G535800 chr7D 77.287 317 48 10 39 353 566040077 566040371 8.060000e-37 165.0
16 TraesCS7A01G535800 chr7D 77.698 139 28 3 220 356 439866619 439866482 8.350000e-12 82.4
17 TraesCS7A01G535800 chr7B 92.055 2165 130 19 1215 3351 714759008 714761158 0.000000e+00 3007.0
18 TraesCS7A01G535800 chr7B 89.991 2288 153 37 727 2980 714739299 714741544 0.000000e+00 2887.0
19 TraesCS7A01G535800 chr7B 91.700 253 19 2 727 978 714758531 714758782 2.070000e-92 350.0
20 TraesCS7A01G535800 chr7B 78.740 508 56 24 27 506 714738397 714738880 3.550000e-75 292.0
21 TraesCS7A01G535800 chr7B 93.333 60 4 0 443 502 714758054 714758113 4.990000e-14 89.8
22 TraesCS7A01G535800 chr2B 80.892 314 41 7 45 356 601432642 601432938 2.820000e-56 230.0
23 TraesCS7A01G535800 chr3B 79.811 317 46 7 45 359 744600363 744600063 7.890000e-52 215.0
24 TraesCS7A01G535800 chr3B 93.023 43 2 1 362 403 260646539 260646581 1.090000e-05 62.1
25 TraesCS7A01G535800 chrUn 80.669 269 40 6 1174 1433 93249450 93249185 7.950000e-47 198.0
26 TraesCS7A01G535800 chr4B 89.474 57 6 0 298 354 89923450 89923394 5.030000e-09 73.1
27 TraesCS7A01G535800 chr6D 97.222 36 1 0 369 404 13965083 13965118 1.090000e-05 62.1
28 TraesCS7A01G535800 chr6B 93.023 43 2 1 362 403 124627378 124627336 1.090000e-05 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G535800 chr7A 713403032 713406661 3629 False 6704.000000 6704 100.000000 1 3630 1 chr7A.!!$F3 3629
1 TraesCS7A01G535800 chr7A 713331625 713335252 3627 False 6569.000000 6569 99.339000 1 3630 1 chr7A.!!$F2 3629
2 TraesCS7A01G535800 chr7A 713467663 713471280 3617 False 6488.000000 6488 98.981000 1 3630 1 chr7A.!!$F4 3629
3 TraesCS7A01G535800 chr7A 713648367 713651577 3210 False 5164.000000 5164 95.671000 1 3221 1 chr7A.!!$F7 3220
4 TraesCS7A01G535800 chr7A 713554744 713557005 2261 False 4100.000000 4100 99.381000 1369 3630 1 chr7A.!!$F5 2261
5 TraesCS7A01G535800 chr7A 713263717 713267330 3613 False 2807.500000 5374 92.195000 258 3630 2 chr7A.!!$F8 3372
6 TraesCS7A01G535800 chr7A 713614746 713616582 1836 False 2697.000000 2697 93.197000 1383 3221 1 chr7A.!!$F6 1838
7 TraesCS7A01G535800 chr7A 713525422 713529285 3863 False 2526.000000 3319 99.541000 1 3630 2 chr7A.!!$F9 3629
8 TraesCS7A01G535800 chr7D 619199808 619202536 2728 False 3312.000000 3312 89.050000 546 3221 1 chr7D.!!$F2 2675
9 TraesCS7A01G535800 chr7D 619229969 619232714 2745 False 1838.000000 3223 90.400000 121 2820 2 chr7D.!!$F3 2699
10 TraesCS7A01G535800 chr7B 714738397 714741544 3147 False 1589.500000 2887 84.365500 27 2980 2 chr7B.!!$F1 2953
11 TraesCS7A01G535800 chr7B 714758054 714761158 3104 False 1148.933333 3007 92.362667 443 3351 3 chr7B.!!$F2 2908

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
845 1490 2.311688 ATTCTTAGTCTGGCCGCGGG 62.312 60.000 29.38 10.87 0.0 6.13 F
2005 2885 3.937706 AGTAACATCTCTTGCATGCAGAC 59.062 43.478 21.50 8.66 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2005 2885 6.362551 CGTCACGTTCCCAATATAACTATCAG 59.637 42.308 0.0 0.0 0.00 2.90 R
2974 3868 0.468226 CATACCCGTGCTACCACCAT 59.532 55.000 0.0 0.0 38.79 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
845 1490 2.311688 ATTCTTAGTCTGGCCGCGGG 62.312 60.000 29.38 10.87 0.00 6.13
2005 2885 3.937706 AGTAACATCTCTTGCATGCAGAC 59.062 43.478 21.50 8.66 0.00 3.51
2974 3868 0.753867 TTGAGGTAACGCTCCACACA 59.246 50.000 0.00 0.00 46.39 3.72
3169 4075 5.526111 CCGTTGTTCCCATACCTGTAATTAG 59.474 44.000 0.00 0.00 0.00 1.73
3528 4434 2.187707 CGCAAAATGATGCTGCCTAAC 58.812 47.619 0.00 0.00 44.21 2.34
3594 4500 6.152831 ACCAAGAACTTCTAGCAAAACAAGTT 59.847 34.615 5.04 5.04 40.88 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
845 1490 4.137390 CGTACGTACGCTTGTAGCTATAC 58.863 47.826 32.36 5.29 43.14 1.47
988 1670 0.905357 AGCTTCATGGTTACGAGGCT 59.095 50.000 0.00 0.00 39.50 4.58
2005 2885 6.362551 CGTCACGTTCCCAATATAACTATCAG 59.637 42.308 0.00 0.00 0.00 2.90
2974 3868 0.468226 CATACCCGTGCTACCACCAT 59.532 55.000 0.00 0.00 38.79 3.55
3528 4434 5.556915 TGTAAACAGATACCACCCTTTGAG 58.443 41.667 0.00 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.