Multiple sequence alignment - TraesCS7A01G535700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G535700 chr7A 100.000 3631 0 0 1 3631 713331623 713335253 0.000000e+00 6706.0
1 TraesCS7A01G535700 chr7A 99.340 3634 20 3 1 3631 713403030 713406662 0.000000e+00 6575.0
2 TraesCS7A01G535700 chr7A 98.954 3632 26 3 1 3631 713467661 713471281 0.000000e+00 6486.0
3 TraesCS7A01G535700 chr7A 98.459 3050 34 5 584 3631 713264293 713267331 0.000000e+00 5360.0
4 TraesCS7A01G535700 chr7A 95.549 3235 109 17 1 3222 713648365 713651577 0.000000e+00 5144.0
5 TraesCS7A01G535700 chr7A 99.293 2264 14 2 1369 3631 713554744 713557006 0.000000e+00 4091.0
6 TraesCS7A01G535700 chr7A 99.345 1831 11 1 1802 3631 713527456 713529286 0.000000e+00 3314.0
7 TraesCS7A01G535700 chr7A 92.984 1853 101 14 1383 3222 713614746 713616582 0.000000e+00 2675.0
8 TraesCS7A01G535700 chr7A 99.262 949 5 1 1 947 713525420 713526368 0.000000e+00 1712.0
9 TraesCS7A01G535700 chr7A 85.417 240 20 7 258 491 713263717 713263947 6.060000e-58 235.0
10 TraesCS7A01G535700 chr7A 78.191 188 32 8 177 359 128001403 128001220 1.070000e-20 111.0
11 TraesCS7A01G535700 chr7D 88.937 2766 180 52 546 3222 619199808 619202536 0.000000e+00 3297.0
12 TraesCS7A01G535700 chr7D 92.625 2278 105 25 587 2821 619230457 619232714 0.000000e+00 3217.0
13 TraesCS7A01G535700 chr7D 88.325 394 29 3 123 509 619229969 619230352 1.190000e-124 457.0
14 TraesCS7A01G535700 chr7D 77.698 139 28 3 220 356 439866619 439866482 8.360000e-12 82.4
15 TraesCS7A01G535700 chr7B 91.824 2165 136 18 1215 3352 714759008 714761158 0.000000e+00 2979.0
16 TraesCS7A01G535700 chr7B 89.912 2280 157 33 727 2973 714739299 714741538 0.000000e+00 2868.0
17 TraesCS7A01G535700 chr7B 92.095 253 18 2 727 978 714758531 714758782 4.460000e-94 355.0
18 TraesCS7A01G535700 chr7B 78.458 506 59 23 29 506 714738397 714738880 5.930000e-73 285.0
19 TraesCS7A01G535700 chr7B 93.333 60 4 0 443 502 714758054 714758113 4.990000e-14 89.8
20 TraesCS7A01G535700 chr1A 79.560 318 49 8 46 359 505493164 505492859 2.840000e-51 213.0
21 TraesCS7A01G535700 chrUn 80.669 269 40 6 1174 1433 93249450 93249185 7.950000e-47 198.0
22 TraesCS7A01G535700 chr4B 89.474 57 6 0 298 354 89923450 89923394 5.030000e-09 73.1
23 TraesCS7A01G535700 chr6D 97.222 36 1 0 369 404 13965083 13965118 1.090000e-05 62.1
24 TraesCS7A01G535700 chr6B 97.222 36 1 0 368 403 124627371 124627336 1.090000e-05 62.1
25 TraesCS7A01G535700 chr2A 97.222 36 1 0 369 404 724728574 724728539 1.090000e-05 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G535700 chr7A 713331623 713335253 3630 False 6706.000000 6706 100.000000 1 3631 1 chr7A.!!$F1 3630
1 TraesCS7A01G535700 chr7A 713403030 713406662 3632 False 6575.000000 6575 99.340000 1 3631 1 chr7A.!!$F2 3630
2 TraesCS7A01G535700 chr7A 713467661 713471281 3620 False 6486.000000 6486 98.954000 1 3631 1 chr7A.!!$F3 3630
3 TraesCS7A01G535700 chr7A 713648365 713651577 3212 False 5144.000000 5144 95.549000 1 3222 1 chr7A.!!$F6 3221
4 TraesCS7A01G535700 chr7A 713554744 713557006 2262 False 4091.000000 4091 99.293000 1369 3631 1 chr7A.!!$F4 2262
5 TraesCS7A01G535700 chr7A 713263717 713267331 3614 False 2797.500000 5360 91.938000 258 3631 2 chr7A.!!$F7 3373
6 TraesCS7A01G535700 chr7A 713614746 713616582 1836 False 2675.000000 2675 92.984000 1383 3222 1 chr7A.!!$F5 1839
7 TraesCS7A01G535700 chr7A 713525420 713529286 3866 False 2513.000000 3314 99.303500 1 3631 2 chr7A.!!$F8 3630
8 TraesCS7A01G535700 chr7D 619199808 619202536 2728 False 3297.000000 3297 88.937000 546 3222 1 chr7D.!!$F1 2676
9 TraesCS7A01G535700 chr7D 619229969 619232714 2745 False 1837.000000 3217 90.475000 123 2821 2 chr7D.!!$F2 2698
10 TraesCS7A01G535700 chr7B 714738397 714741538 3141 False 1576.500000 2868 84.185000 29 2973 2 chr7B.!!$F1 2944
11 TraesCS7A01G535700 chr7B 714758054 714761158 3104 False 1141.266667 2979 92.417333 443 3352 3 chr7B.!!$F2 2909

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
74 75 0.976641 AATGAAGACCGAGCTCCACA 59.023 50.000 8.47 0.17 0.0 4.17 F
1141 1833 9.245962 GCGATCTACAAGTATACATGTTAGTTT 57.754 33.333 18.02 7.11 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1830 2712 1.098129 CGGAGATGGAGACGAGAGCA 61.098 60.0 0.0 0.0 0.0 4.26 R
3060 3969 0.892755 AGGCTGAACGAACGTATGGA 59.107 50.0 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 1.734465 CAAATGAAGACCGAGCTCCAC 59.266 52.381 8.47 0.00 0.00 4.02
74 75 0.976641 AATGAAGACCGAGCTCCACA 59.023 50.000 8.47 0.17 0.00 4.17
1141 1833 9.245962 GCGATCTACAAGTATACATGTTAGTTT 57.754 33.333 18.02 7.11 0.00 2.66
2236 3119 5.539955 GGGAACAAGAATAATGCCCACATAT 59.460 40.000 0.00 0.00 34.62 1.78
3060 3969 2.901840 CACACTGGCAACCGCACT 60.902 61.111 0.00 0.00 41.24 4.40
3245 4154 3.960102 GGGGATGACCTTTGCATTAATCA 59.040 43.478 0.00 0.00 40.03 2.57
3251 4160 8.078596 GGATGACCTTTGCATTAATCAGTATTC 58.921 37.037 0.00 0.00 0.00 1.75
3569 4478 1.226101 CATCGTGTGCGTGCATTCC 60.226 57.895 0.00 0.00 39.49 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 5.163814 CGAGGCTTTCAAATTAAGTCCTCTG 60.164 44.000 17.98 12.32 40.21 3.35
74 75 4.938226 CGAGGCTTTCAAATTAAGTCCTCT 59.062 41.667 17.98 0.14 40.21 3.69
363 368 3.150767 AGACCGAGCTACATGGATACTC 58.849 50.000 0.00 0.00 37.61 2.59
1830 2712 1.098129 CGGAGATGGAGACGAGAGCA 61.098 60.000 0.00 0.00 0.00 4.26
2236 3119 1.623811 GAAGGCAGTGTAGAGGTCCAA 59.376 52.381 0.00 0.00 0.00 3.53
3060 3969 0.892755 AGGCTGAACGAACGTATGGA 59.107 50.000 0.00 0.00 0.00 3.41
3245 4154 6.686630 TGCCATTTGAATTGAAACGAATACT 58.313 32.000 0.00 0.00 0.00 2.12
3251 4160 6.253746 TGTTTTTGCCATTTGAATTGAAACG 58.746 32.000 0.00 0.00 0.00 3.60
3569 4478 5.499139 TGTTTTGCTAGAAGTTCTTGGTG 57.501 39.130 11.40 1.06 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.