Multiple sequence alignment - TraesCS7A01G535200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G535200 chr7A 100.000 4467 0 0 1 4467 713048181 713043715 0.000000e+00 8187.0
1 TraesCS7A01G535200 chr7A 99.241 2634 18 1 1 2634 713005337 713002706 0.000000e+00 4752.0
2 TraesCS7A01G535200 chr7A 99.244 397 2 1 2654 3049 713002387 713001991 0.000000e+00 715.0
3 TraesCS7A01G535200 chr7A 98.953 382 4 0 4086 4467 713000664 713000283 0.000000e+00 684.0
4 TraesCS7A01G535200 chrUn 99.370 2541 14 1 94 2634 337236469 337233931 0.000000e+00 4602.0
5 TraesCS7A01G535200 chrUn 99.168 1443 11 1 94 1536 399549954 399548513 0.000000e+00 2597.0
6 TraesCS7A01G535200 chrUn 98.935 1409 7 1 3067 4467 397687785 397689193 0.000000e+00 2512.0
7 TraesCS7A01G535200 chrUn 99.453 1097 3 2 1538 2634 440568176 440569269 0.000000e+00 1989.0
8 TraesCS7A01G535200 chrUn 99.093 1103 10 0 3365 4467 228464672 228465774 0.000000e+00 1982.0
9 TraesCS7A01G535200 chrUn 99.326 1039 7 0 3429 4467 440850752 440849714 0.000000e+00 1881.0
10 TraesCS7A01G535200 chrUn 87.910 1067 107 7 3411 4467 268327732 268328786 0.000000e+00 1236.0
11 TraesCS7A01G535200 chrUn 81.569 1530 190 53 678 2182 268323578 268325040 0.000000e+00 1179.0
12 TraesCS7A01G535200 chrUn 100.000 92 0 0 1 92 434616710 434616801 2.140000e-38 171.0
13 TraesCS7A01G535200 chr7B 86.106 2008 219 36 6 1996 714508268 714506304 0.000000e+00 2108.0
14 TraesCS7A01G535200 chr7B 88.527 1229 112 13 3243 4467 714377415 714376212 0.000000e+00 1461.0
15 TraesCS7A01G535200 chr7B 80.556 2052 265 74 678 2692 714637893 714639847 0.000000e+00 1456.0
16 TraesCS7A01G535200 chr7B 86.683 1239 127 25 3243 4467 714505131 714503917 0.000000e+00 1339.0
17 TraesCS7A01G535200 chr7B 89.202 1065 94 11 3411 4467 714640685 714641736 0.000000e+00 1310.0
18 TraesCS7A01G535200 chr7B 82.550 1255 151 35 685 1920 714379641 714378436 0.000000e+00 1042.0
19 TraesCS7A01G535200 chr7B 78.958 960 149 36 1999 2943 714378333 714377412 4.940000e-169 604.0
20 TraesCS7A01G535200 chr7B 77.189 491 65 23 2066 2523 714505987 714505511 4.460000e-60 243.0
21 TraesCS7A01G535200 chr7B 84.270 89 10 1 1982 2070 714506143 714506059 2.860000e-12 84.2
22 TraesCS7A01G535200 chr1D 76.671 733 157 11 3501 4227 487895833 487895109 1.160000e-105 394.0
23 TraesCS7A01G535200 chr1A 76.096 753 152 23 3488 4227 586518382 586517645 7.060000e-98 368.0
24 TraesCS7A01G535200 chr6B 72.676 355 78 17 1440 1788 26487807 26487466 2.840000e-17 100.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G535200 chr7A 713043715 713048181 4466 True 8187.000000 8187 100.0000 1 4467 1 chr7A.!!$R1 4466
1 TraesCS7A01G535200 chr7A 713000283 713005337 5054 True 2050.333333 4752 99.1460 1 4467 3 chr7A.!!$R2 4466
2 TraesCS7A01G535200 chrUn 337233931 337236469 2538 True 4602.000000 4602 99.3700 94 2634 1 chrUn.!!$R1 2540
3 TraesCS7A01G535200 chrUn 399548513 399549954 1441 True 2597.000000 2597 99.1680 94 1536 1 chrUn.!!$R2 1442
4 TraesCS7A01G535200 chrUn 397687785 397689193 1408 False 2512.000000 2512 98.9350 3067 4467 1 chrUn.!!$F2 1400
5 TraesCS7A01G535200 chrUn 440568176 440569269 1093 False 1989.000000 1989 99.4530 1538 2634 1 chrUn.!!$F4 1096
6 TraesCS7A01G535200 chrUn 228464672 228465774 1102 False 1982.000000 1982 99.0930 3365 4467 1 chrUn.!!$F1 1102
7 TraesCS7A01G535200 chrUn 440849714 440850752 1038 True 1881.000000 1881 99.3260 3429 4467 1 chrUn.!!$R3 1038
8 TraesCS7A01G535200 chrUn 268323578 268328786 5208 False 1207.500000 1236 84.7395 678 4467 2 chrUn.!!$F5 3789
9 TraesCS7A01G535200 chr7B 714637893 714641736 3843 False 1383.000000 1456 84.8790 678 4467 2 chr7B.!!$F1 3789
10 TraesCS7A01G535200 chr7B 714376212 714379641 3429 True 1035.666667 1461 83.3450 685 4467 3 chr7B.!!$R1 3782
11 TraesCS7A01G535200 chr7B 714503917 714508268 4351 True 943.550000 2108 83.5620 6 4467 4 chr7B.!!$R2 4461
12 TraesCS7A01G535200 chr1D 487895109 487895833 724 True 394.000000 394 76.6710 3501 4227 1 chr1D.!!$R1 726
13 TraesCS7A01G535200 chr1A 586517645 586518382 737 True 368.000000 368 76.0960 3488 4227 1 chr1A.!!$R1 739

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
306 308 0.912486 GGATAGGTGGTCAGGCAAGT 59.088 55.000 0.00 0.0 0.00 3.16 F
647 654 6.879458 AGAAGGTTAATTTCATAGAAGCACGT 59.121 34.615 5.74 0.0 0.00 4.49 F
2637 4608 4.530161 TGTAGGGGTTCAAAATTTCCCATG 59.470 41.667 13.23 0.0 41.51 3.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1818 1877 6.877855 CACAATTATCAGCATCCACTAGCTAT 59.122 38.462 0.0 0.0 39.50 2.97 R
2643 4614 6.067263 TGGTGAACCAATACGAAAAAGAAG 57.933 37.500 0.0 0.0 44.35 2.85 R
4306 8294 1.210478 CTTGGACCCTCCGAATGACAT 59.790 52.381 0.0 0.0 40.17 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
306 308 0.912486 GGATAGGTGGTCAGGCAAGT 59.088 55.000 0.00 0.00 0.00 3.16
486 489 7.959175 ACGCCAAGATATGTAGTTAAAGGATA 58.041 34.615 0.00 0.00 0.00 2.59
647 654 6.879458 AGAAGGTTAATTTCATAGAAGCACGT 59.121 34.615 5.74 0.00 0.00 4.49
1817 1876 4.581824 GTCACTCATGGAATTGCATGGTAT 59.418 41.667 31.77 18.64 0.00 2.73
1818 1877 5.764686 GTCACTCATGGAATTGCATGGTATA 59.235 40.000 31.77 16.67 0.00 1.47
2636 4607 4.757692 TGTAGGGGTTCAAAATTTCCCAT 58.242 39.130 13.23 9.40 41.51 4.00
2637 4608 4.530161 TGTAGGGGTTCAAAATTTCCCATG 59.470 41.667 13.23 0.00 41.51 3.66
2643 4614 5.647658 GGGTTCAAAATTTCCCATGGATTTC 59.352 40.000 15.22 0.00 39.68 2.17
2984 5724 1.254026 CGGTACTCTCCTGTCCACAA 58.746 55.000 0.00 0.00 0.00 3.33
4121 8103 3.184541 GCAAAGTGCATGATGTGATTCC 58.815 45.455 0.00 0.00 44.26 3.01
4223 8205 4.659172 CAAGCCCAAGGTCCGCCA 62.659 66.667 0.00 0.00 37.19 5.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 255 1.030488 GGTCCACGACGATGAGGAGA 61.030 60.000 0.00 0.0 32.65 3.71
386 389 2.717044 CCTACATGTCGGACGGCCA 61.717 63.158 8.76 0.0 0.00 5.36
441 444 2.040544 CGTCCTTGCCGCTTCCATT 61.041 57.895 0.00 0.0 0.00 3.16
486 489 3.116174 GTCTCACCCTTCCTCCCTTAAT 58.884 50.000 0.00 0.0 0.00 1.40
647 654 0.980754 TGAGCTGGGCCGATCCTTTA 60.981 55.000 10.29 0.0 34.39 1.85
1817 1876 8.037166 CACAATTATCAGCATCCACTAGCTATA 58.963 37.037 0.00 0.0 39.50 1.31
1818 1877 6.877855 CACAATTATCAGCATCCACTAGCTAT 59.122 38.462 0.00 0.0 39.50 2.97
2636 4607 7.519032 ACCAATACGAAAAAGAAGAAATCCA 57.481 32.000 0.00 0.0 0.00 3.41
2637 4608 8.079809 TGAACCAATACGAAAAAGAAGAAATCC 58.920 33.333 0.00 0.0 0.00 3.01
2643 4614 6.067263 TGGTGAACCAATACGAAAAAGAAG 57.933 37.500 0.00 0.0 44.35 2.85
4223 8205 5.757850 AGAACTCGAGCAAAAGAACAATT 57.242 34.783 13.61 0.0 0.00 2.32
4306 8294 1.210478 CTTGGACCCTCCGAATGACAT 59.790 52.381 0.00 0.0 40.17 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.