Multiple sequence alignment - TraesCS7A01G531300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G531300 chr7A 100.000 3520 0 0 1 3520 709869813 709873332 0.000000e+00 6501
1 TraesCS7A01G531300 chr7A 80.989 1436 230 33 1144 2553 522256094 522257512 0.000000e+00 1099
2 TraesCS7A01G531300 chr7A 76.369 931 176 32 2624 3517 522257609 522258532 8.900000e-126 460
3 TraesCS7A01G531300 chr7A 79.834 481 81 13 333 800 522247051 522247528 1.570000e-88 337
4 TraesCS7A01G531300 chr7A 87.349 166 20 1 978 1143 522247677 522247841 4.640000e-44 189
5 TraesCS7A01G531300 chrUn 98.675 2566 33 1 1 2565 47722348 47719783 0.000000e+00 4549
6 TraesCS7A01G531300 chrUn 98.674 2565 34 0 1 2565 289578599 289581163 0.000000e+00 4549
7 TraesCS7A01G531300 chrUn 98.854 960 4 3 2565 3520 47719754 47718798 0.000000e+00 1705
8 TraesCS7A01G531300 chrUn 98.750 960 10 2 2563 3520 289581190 289582149 0.000000e+00 1705
9 TraesCS7A01G531300 chr4A 96.577 2571 67 11 2 2570 25200165 25202716 0.000000e+00 4241
10 TraesCS7A01G531300 chr4A 96.840 886 25 2 2566 3448 25202740 25203625 0.000000e+00 1478
11 TraesCS7A01G531300 chr4A 98.095 105 1 1 3416 3520 25203619 25203722 7.760000e-42 182
12 TraesCS7A01G531300 chr1A 93.333 1650 92 7 2 1646 497227997 497226361 0.000000e+00 2422
13 TraesCS7A01G531300 chr1A 93.688 903 52 4 1672 2570 497225905 497225004 0.000000e+00 1347
14 TraesCS7A01G531300 chr1A 88.387 155 14 3 2563 2713 497224982 497224828 2.160000e-42 183
15 TraesCS7A01G531300 chr3D 83.587 1645 231 31 933 2555 515700457 515698830 0.000000e+00 1506
16 TraesCS7A01G531300 chr3D 83.445 1643 236 29 933 2554 546581740 546580113 0.000000e+00 1495
17 TraesCS7A01G531300 chr3D 91.011 267 24 0 2 268 515701415 515701149 9.290000e-96 361
18 TraesCS7A01G531300 chr3D 90.637 267 25 0 2 268 546582698 546582432 4.320000e-94 355
19 TraesCS7A01G531300 chr3D 84.592 331 49 2 3189 3518 515698261 515697932 9.420000e-86 327
20 TraesCS7A01G531300 chr3D 84.592 331 48 2 3189 3518 546579541 546579213 3.390000e-85 326
21 TraesCS7A01G531300 chr3D 83.642 324 35 12 2626 2944 546580008 546579698 4.450000e-74 289
22 TraesCS7A01G531300 chr3D 83.766 308 36 8 2626 2931 515698728 515698433 2.680000e-71 279
23 TraesCS7A01G531300 chr7D 83.009 1642 242 27 933 2554 532955966 532957590 0.000000e+00 1452
24 TraesCS7A01G531300 chr7D 90.262 267 26 0 2 268 532955008 532955274 2.010000e-92 350
25 TraesCS7A01G531300 chr7D 84.290 331 50 2 3189 3518 532958162 532958491 4.380000e-84 322
26 TraesCS7A01G531300 chr7D 84.091 308 35 8 2626 2931 532957695 532957990 5.750000e-73 285
27 TraesCS7A01G531300 chr3B 82.663 323 54 2 3132 3453 615890566 615890245 5.750000e-73 285
28 TraesCS7A01G531300 chr3B 92.857 140 10 0 2791 2930 615890921 615890782 1.660000e-48 204


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G531300 chr7A 709869813 709873332 3519 False 6501.000000 6501 100.000000 1 3520 1 chr7A.!!$F1 3519
1 TraesCS7A01G531300 chr7A 522256094 522258532 2438 False 779.500000 1099 78.679000 1144 3517 2 chr7A.!!$F3 2373
2 TraesCS7A01G531300 chr7A 522247051 522247841 790 False 263.000000 337 83.591500 333 1143 2 chr7A.!!$F2 810
3 TraesCS7A01G531300 chrUn 47718798 47722348 3550 True 3127.000000 4549 98.764500 1 3520 2 chrUn.!!$R1 3519
4 TraesCS7A01G531300 chrUn 289578599 289582149 3550 False 3127.000000 4549 98.712000 1 3520 2 chrUn.!!$F1 3519
5 TraesCS7A01G531300 chr4A 25200165 25203722 3557 False 1967.000000 4241 97.170667 2 3520 3 chr4A.!!$F1 3518
6 TraesCS7A01G531300 chr1A 497224828 497227997 3169 True 1317.333333 2422 91.802667 2 2713 3 chr1A.!!$R1 2711
7 TraesCS7A01G531300 chr3D 515697932 515701415 3483 True 618.250000 1506 85.739000 2 3518 4 chr3D.!!$R1 3516
8 TraesCS7A01G531300 chr3D 546579213 546582698 3485 True 616.250000 1495 85.579000 2 3518 4 chr3D.!!$R2 3516
9 TraesCS7A01G531300 chr7D 532955008 532958491 3483 False 602.250000 1452 85.413000 2 3518 4 chr7D.!!$F1 3516
10 TraesCS7A01G531300 chr3B 615890245 615890921 676 True 244.500000 285 87.760000 2791 3453 2 chr3B.!!$R1 662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
979 1046 1.007964 CGGGAACAAAATGCACGCA 60.008 52.632 0.0 0.0 0.0 5.24 F
1732 2249 2.041485 TCCATGACCAATTTGCAGAGGA 59.959 45.455 0.0 0.0 0.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1876 2401 1.001487 TGCAAGTTGTCGCTGGATTTG 60.001 47.619 4.48 0.0 0.0 2.32 R
3412 4026 8.634335 TGAATTCCTGAAACAACTATTGATCA 57.366 30.769 2.27 0.0 0.0 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 9.504708 AAATTGCCTTTGTGATTTTCATCATTA 57.495 25.926 0.0 0.0 41.64 1.90
740 791 4.629634 CCAATGTTGCGATCTACTTACACA 59.370 41.667 0.0 0.0 0.00 3.72
979 1046 1.007964 CGGGAACAAAATGCACGCA 60.008 52.632 0.0 0.0 0.00 5.24
1553 1640 2.710902 CCGAGATCCGTCCAGCACA 61.711 63.158 0.0 0.0 36.31 4.57
1732 2249 2.041485 TCCATGACCAATTTGCAGAGGA 59.959 45.455 0.0 0.0 0.00 3.71
1734 2251 3.119245 CCATGACCAATTTGCAGAGGAAG 60.119 47.826 0.0 0.0 0.00 3.46
1743 2260 4.380843 TTTGCAGAGGAAGGATAAACCA 57.619 40.909 0.0 0.0 42.04 3.67
1873 2398 2.079925 GGCTCATATCAATCGAAGGGC 58.920 52.381 0.0 0.0 0.00 5.19
1876 2401 3.434984 GCTCATATCAATCGAAGGGCTTC 59.565 47.826 0.0 0.0 36.29 3.86
2054 2581 0.679505 TCACCCTTGTCCACTCGAAG 59.320 55.000 0.0 0.0 0.00 3.79
3412 4026 0.673644 CGAACCTTGTCCCGCAGATT 60.674 55.000 0.0 0.0 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 0.671781 GTCGGAGCAAGCACATGTCT 60.672 55.000 0.00 0.0 0.00 3.41
740 791 0.251341 ACTCTTGCGGGCCATTCTTT 60.251 50.000 4.39 0.0 0.00 2.52
979 1046 0.546122 TCCGATATGTTTGCCAGGCT 59.454 50.000 14.15 0.0 0.00 4.58
1553 1640 0.534203 ACCAAACAAGATCGCCGTGT 60.534 50.000 0.00 0.0 39.14 4.49
1709 2226 4.079844 TCCTCTGCAAATTGGTCATGGATA 60.080 41.667 0.00 0.0 0.00 2.59
1732 2249 4.149598 GTGTTGGGTCTTGGTTTATCCTT 58.850 43.478 0.00 0.0 37.07 3.36
1734 2251 3.492337 TGTGTTGGGTCTTGGTTTATCC 58.508 45.455 0.00 0.0 0.00 2.59
1743 2260 7.175990 ACGTAAATAATTGATGTGTTGGGTCTT 59.824 33.333 0.00 0.0 0.00 3.01
1873 2398 3.558505 CAAGTTGTCGCTGGATTTGAAG 58.441 45.455 0.00 0.0 0.00 3.02
1876 2401 1.001487 TGCAAGTTGTCGCTGGATTTG 60.001 47.619 4.48 0.0 0.00 2.32
1912 2437 3.717400 AGCAGTACATATCTCGTGTGG 57.283 47.619 0.00 0.0 0.00 4.17
2117 2646 1.229428 ACAGTTGTCTGCGAACATGG 58.771 50.000 0.00 0.0 44.77 3.66
2489 3021 3.072330 TGGAATCACAGTGCCAAGAACTA 59.928 43.478 0.00 0.0 0.00 2.24
3412 4026 8.634335 TGAATTCCTGAAACAACTATTGATCA 57.366 30.769 2.27 0.0 0.00 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.