Multiple sequence alignment - TraesCS7A01G526200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G526200 chr7A 100.000 2744 0 0 1 2744 708244614 708247357 0 5068
1 TraesCS7A01G526200 chr7A 98.945 2748 24 4 1 2744 638508678 638505932 0 4909
2 TraesCS7A01G526200 chr6B 99.163 2747 20 2 1 2744 596602871 596600125 0 4942
3 TraesCS7A01G526200 chr6B 98.801 2168 22 3 581 2744 715991505 715989338 0 3856
4 TraesCS7A01G526200 chrUn 99.017 2747 23 3 1 2744 171007273 171010018 0 4920
5 TraesCS7A01G526200 chr1B 98.508 2748 35 5 1 2744 672540211 672542956 0 4843
6 TraesCS7A01G526200 chr5B 98.472 2749 37 4 1 2744 567278982 567281730 0 4839
7 TraesCS7A01G526200 chr2B 98.290 2748 42 3 1 2744 391226256 391223510 0 4809
8 TraesCS7A01G526200 chr2B 97.961 2747 51 3 1 2744 391143792 391146536 0 4758
9 TraesCS7A01G526200 chr4B 98.143 2746 44 4 1 2744 495566953 495569693 0 4782


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G526200 chr7A 708244614 708247357 2743 False 5068 5068 100.000 1 2744 1 chr7A.!!$F1 2743
1 TraesCS7A01G526200 chr7A 638505932 638508678 2746 True 4909 4909 98.945 1 2744 1 chr7A.!!$R1 2743
2 TraesCS7A01G526200 chr6B 596600125 596602871 2746 True 4942 4942 99.163 1 2744 1 chr6B.!!$R1 2743
3 TraesCS7A01G526200 chr6B 715989338 715991505 2167 True 3856 3856 98.801 581 2744 1 chr6B.!!$R2 2163
4 TraesCS7A01G526200 chrUn 171007273 171010018 2745 False 4920 4920 99.017 1 2744 1 chrUn.!!$F1 2743
5 TraesCS7A01G526200 chr1B 672540211 672542956 2745 False 4843 4843 98.508 1 2744 1 chr1B.!!$F1 2743
6 TraesCS7A01G526200 chr5B 567278982 567281730 2748 False 4839 4839 98.472 1 2744 1 chr5B.!!$F1 2743
7 TraesCS7A01G526200 chr2B 391223510 391226256 2746 True 4809 4809 98.290 1 2744 1 chr2B.!!$R1 2743
8 TraesCS7A01G526200 chr2B 391143792 391146536 2744 False 4758 4758 97.961 1 2744 1 chr2B.!!$F1 2743
9 TraesCS7A01G526200 chr4B 495566953 495569693 2740 False 4782 4782 98.143 1 2744 1 chr4B.!!$F1 2743

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
94 95 4.713553 CCTTTTTGTGCAATAAACCCCTT 58.286 39.130 0.0 0.0 0.0 3.95 F
1003 1013 7.327975 TGGTTGTAATAGATCGACTTGAATGT 58.672 34.615 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1093 1103 2.846193 AGCACGTACAACCATCAAACT 58.154 42.857 0.0 0.0 0.00 2.66 R
2494 2510 1.122019 AGGAGAACCCGAGTGCAACT 61.122 55.000 0.0 0.0 44.64 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
94 95 4.713553 CCTTTTTGTGCAATAAACCCCTT 58.286 39.130 0.00 0.0 0.00 3.95
909 919 9.930693 AGAAAGACGAGATTCAGTAAGTAATTT 57.069 29.630 0.00 0.0 0.00 1.82
1003 1013 7.327975 TGGTTGTAATAGATCGACTTGAATGT 58.672 34.615 0.00 0.0 0.00 2.71
1093 1103 0.905357 GAGCCCTGCTTTGGTCTCTA 59.095 55.000 0.00 0.0 39.88 2.43
1119 1129 5.351233 TGATGGTTGTACGTGCTAAAAAG 57.649 39.130 4.97 0.0 0.00 2.27
1643 1654 8.270744 GGATTCTAGGAGCCATATAATGAACAT 58.729 37.037 0.00 0.0 0.00 2.71
1839 1850 6.409234 GGGAGATCCTATTCATGGTAAACACA 60.409 42.308 0.00 0.0 35.95 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 1.523758 AAGCCCAACGAATGTCAGAC 58.476 50.000 0.00 0.00 0.00 3.51
94 95 2.219458 CTATCACTAGTCTTCGGCCGA 58.781 52.381 27.28 27.28 0.00 5.54
458 459 2.639839 CCAGGACCGGAATGATTATCCT 59.360 50.000 9.46 3.85 34.66 3.24
1093 1103 2.846193 AGCACGTACAACCATCAAACT 58.154 42.857 0.00 0.00 0.00 2.66
1643 1654 4.380843 TGGCCAAAAGGAGAAATAGTCA 57.619 40.909 0.61 0.00 0.00 3.41
2397 2413 1.732941 TGCTTTGCGTATCACGGATT 58.267 45.000 0.44 0.00 42.59 3.01
2494 2510 1.122019 AGGAGAACCCGAGTGCAACT 61.122 55.000 0.00 0.00 44.64 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.