Multiple sequence alignment - TraesCS7A01G526100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G526100 chr7A 100.000 2235 0 0 1 2235 708245649 708243415 0 4128
1 TraesCS7A01G526100 chr7A 98.704 2237 24 4 1 2234 638507640 638509874 0 3965
2 TraesCS7A01G526100 chr7A 97.005 2237 53 7 1 2235 211364403 211366627 0 3747
3 TraesCS7A01G526100 chr6B 98.972 2237 19 3 1 2235 596601834 596604068 0 4000
4 TraesCS7A01G526100 chrUn 98.793 2237 23 3 1 2235 171008310 171006076 0 3978
5 TraesCS7A01G526100 chr1B 98.391 2237 30 5 1 2235 672541246 672539014 0 3927
6 TraesCS7A01G526100 chr5B 98.347 2238 33 3 1 2235 567280020 567277784 0 3925
7 TraesCS7A01G526100 chr7D 98.122 2237 33 4 1 2235 382089823 382087594 0 3890
8 TraesCS7A01G526100 chr7D 97.901 2239 34 5 1 2235 626711171 626713400 0 3862
9 TraesCS7A01G526100 chr2B 98.035 2239 39 3 1 2235 391225217 391227454 0 3886


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G526100 chr7A 708243415 708245649 2234 True 4128 4128 100.000 1 2235 1 chr7A.!!$R1 2234
1 TraesCS7A01G526100 chr7A 638507640 638509874 2234 False 3965 3965 98.704 1 2234 1 chr7A.!!$F2 2233
2 TraesCS7A01G526100 chr7A 211364403 211366627 2224 False 3747 3747 97.005 1 2235 1 chr7A.!!$F1 2234
3 TraesCS7A01G526100 chr6B 596601834 596604068 2234 False 4000 4000 98.972 1 2235 1 chr6B.!!$F1 2234
4 TraesCS7A01G526100 chrUn 171006076 171008310 2234 True 3978 3978 98.793 1 2235 1 chrUn.!!$R1 2234
5 TraesCS7A01G526100 chr1B 672539014 672541246 2232 True 3927 3927 98.391 1 2235 1 chr1B.!!$R1 2234
6 TraesCS7A01G526100 chr5B 567277784 567280020 2236 True 3925 3925 98.347 1 2235 1 chr5B.!!$R1 2234
7 TraesCS7A01G526100 chr7D 382087594 382089823 2229 True 3890 3890 98.122 1 2235 1 chr7D.!!$R1 2234
8 TraesCS7A01G526100 chr7D 626711171 626713400 2229 False 3862 3862 97.901 1 2235 1 chr7D.!!$F1 2234
9 TraesCS7A01G526100 chr2B 391225217 391227454 2237 False 3886 3886 98.035 1 2235 1 chr2B.!!$F1 2234

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
941 949 2.219458 CTATCACTAGTCTTCGGCCGA 58.781 52.381 27.28 27.28 0.0 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1793 1809 0.689055 GGTGGGGTACTTCGAAGGTT 59.311 55.0 27.86 11.55 0.0 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
577 583 2.639839 CCAGGACCGGAATGATTATCCT 59.360 50.000 9.46 3.85 34.66 3.24
941 949 2.219458 CTATCACTAGTCTTCGGCCGA 58.781 52.381 27.28 27.28 0.00 5.54
1008 1016 1.523758 AAGCCCAACGAATGTCAGAC 58.476 50.000 0.00 0.00 0.00 3.51
1323 1334 4.579340 TCGCATTTTAGGTCGAGTAGAGAT 59.421 41.667 0.00 0.00 0.00 2.75
1430 1441 5.337009 GGCATTTGACATCCAGAGACAAAAT 60.337 40.000 0.00 0.00 34.86 1.82
1805 1821 2.301009 GGGTCTCCAAACCTTCGAAGTA 59.699 50.000 23.03 1.64 39.42 2.24
1923 1939 6.205464 CACCATCGCAATAACAATAAGGAGAT 59.795 38.462 0.00 0.00 0.00 2.75
1926 1942 5.122519 TCGCAATAACAATAAGGAGATGCA 58.877 37.500 0.00 0.00 0.00 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 7.327975 TGGTTGTAATAGATCGACTTGAATGT 58.672 34.615 0.00 0.00 0.00 2.71
126 127 9.930693 AGAAAGACGAGATTCAGTAAGTAATTT 57.069 29.630 0.00 0.00 0.00 1.82
941 949 4.713553 CCTTTTTGTGCAATAAACCCCTT 58.286 39.130 0.00 0.00 0.00 3.95
1250 1261 3.193691 CGCTCTCCGTCCATATTTAGGAT 59.806 47.826 0.00 0.00 37.52 3.24
1323 1334 1.990060 GCCCACAGACTCCCTAGCA 60.990 63.158 0.00 0.00 0.00 3.49
1430 1441 0.105964 CCAGTTTCGTGTGGGACTGA 59.894 55.000 4.07 0.00 41.46 3.41
1793 1809 0.689055 GGTGGGGTACTTCGAAGGTT 59.311 55.000 27.86 11.55 0.00 3.50
1923 1939 1.080772 GGATGACGACGTCACTGCA 60.081 57.895 31.34 10.81 45.65 4.41
1926 1942 1.200252 CTTCTGGATGACGACGTCACT 59.800 52.381 31.34 20.10 45.65 3.41
2066 2082 5.513141 GCGATTGGCTTCACTTTAGATTTTC 59.487 40.000 0.00 0.00 39.11 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.