Multiple sequence alignment - TraesCS7A01G525200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G525200 chr7A 100.000 2756 0 0 1 2756 707808375 707805620 0.000000e+00 5090
1 TraesCS7A01G525200 chr7A 99.238 2757 17 3 1 2756 710495057 710497810 0.000000e+00 4972
2 TraesCS7A01G525200 chr7A 92.308 52 4 0 2643 2694 661849371 661849422 1.060000e-09 75
3 TraesCS7A01G525200 chr7B 87.856 1054 103 13 981 2017 707647889 707646844 0.000000e+00 1214
4 TraesCS7A01G525200 chr7B 87.591 685 43 17 1 646 707649154 707648473 0.000000e+00 756
5 TraesCS7A01G525200 chr7B 97.175 177 3 1 2404 2578 707646278 707646102 5.770000e-77 298
6 TraesCS7A01G525200 chr7B 86.697 218 19 2 2013 2230 707646770 707646563 1.650000e-57 233
7 TraesCS7A01G525200 chr7B 86.154 195 6 10 801 995 707648463 707648290 1.010000e-44 191
8 TraesCS7A01G525200 chr7B 92.920 113 7 1 2299 2410 707646562 707646450 2.200000e-36 163
9 TraesCS7A01G525200 chr4A 90.991 111 10 0 2646 2756 38777690 38777580 1.710000e-32 150


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G525200 chr7A 707805620 707808375 2755 True 5090.000000 5090 100.000000 1 2756 1 chr7A.!!$R1 2755
1 TraesCS7A01G525200 chr7A 710495057 710497810 2753 False 4972.000000 4972 99.238000 1 2756 1 chr7A.!!$F2 2755
2 TraesCS7A01G525200 chr7B 707646102 707649154 3052 True 475.833333 1214 89.732167 1 2578 6 chr7B.!!$R1 2577

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1737 2203 2.093869 CCATGGTTTCTTTGGCTGGATG 60.094 50.0 2.57 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2711 3438 2.221169 TGGAGCATTCACGCCAATATC 58.779 47.619 0.0 0.0 36.49 1.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1737 2203 2.093869 CCATGGTTTCTTTGGCTGGATG 60.094 50.000 2.57 0.0 0.00 3.51
2201 2747 2.813754 TGGCTGAAGTCTCCGAAAAATG 59.186 45.455 0.00 0.0 0.00 2.32
2243 2789 5.048846 AGGACCTGCCGAATTTGTATATT 57.951 39.130 0.00 0.0 43.43 1.28
2622 3349 1.574263 GCCAAGTAGTCCCTTCTCCT 58.426 55.000 0.00 0.0 0.00 3.69
2711 3438 3.904136 AACCTTGCAGACTCGAAATTG 57.096 42.857 0.00 0.0 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
791 829 1.077068 GCCGGGGATGATTTGACCA 60.077 57.895 2.18 0.0 0.00 4.02
1737 2203 4.878397 CAGAGTCAGTTTTGGGATATGGAC 59.122 45.833 0.00 0.0 0.00 4.02
2172 2718 2.418471 GGAGACTTCAGCCATCACTCAG 60.418 54.545 0.00 0.0 0.00 3.35
2176 2722 0.532573 TCGGAGACTTCAGCCATCAC 59.467 55.000 0.00 0.0 0.00 3.06
2201 2747 7.444487 AGGTCCTTCGGCTATCATTATTTTTAC 59.556 37.037 0.00 0.0 0.00 2.01
2243 2789 9.120538 AGACAGTTAAGAAAAGCAAAGTTCATA 57.879 29.630 0.00 0.0 0.00 2.15
2711 3438 2.221169 TGGAGCATTCACGCCAATATC 58.779 47.619 0.00 0.0 36.49 1.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.