Multiple sequence alignment - TraesCS7A01G517300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G517300 chr7A 100.000 2327 0 0 1 2327 701572157 701569831 0.000000e+00 4298
1 TraesCS7A01G517300 chr7A 98.976 1367 13 1 1 1367 238818648 238817283 0.000000e+00 2446
2 TraesCS7A01G517300 chr7A 81.234 1183 124 41 420 1573 29431753 29430640 0.000000e+00 865
3 TraesCS7A01G517300 chr7A 97.794 272 5 1 1 272 56561867 56562137 3.500000e-128 468
4 TraesCS7A01G517300 chr7A 96.667 240 6 1 1334 1573 238817282 238817045 4.660000e-107 398
5 TraesCS7A01G517300 chr7A 78.387 620 110 15 1701 2314 701620690 701620089 4.690000e-102 381
6 TraesCS7A01G517300 chr7A 88.511 235 21 2 1700 1934 701599868 701599640 1.760000e-71 279
7 TraesCS7A01G517300 chr7A 86.275 153 18 3 2164 2313 701599546 701599394 1.850000e-36 163
8 TraesCS7A01G517300 chr4A 99.268 1367 10 0 1 1367 547984024 547982658 0.000000e+00 2470
9 TraesCS7A01G517300 chr4A 99.167 240 1 1 1334 1573 547982657 547982419 4.590000e-117 431
10 TraesCS7A01G517300 chr1B 92.498 1093 67 7 1 1092 427529870 427530948 0.000000e+00 1550
11 TraesCS7A01G517300 chr1B 81.437 1169 131 43 423 1572 674377706 674376605 0.000000e+00 878
12 TraesCS7A01G517300 chr1B 74.212 539 93 27 1701 2231 10048443 10047943 1.420000e-42 183
13 TraesCS7A01G517300 chr3B 92.269 983 63 3 1 980 54077222 54078194 0.000000e+00 1382
14 TraesCS7A01G517300 chr3B 91.054 503 41 1 478 980 54153406 54153904 0.000000e+00 676
15 TraesCS7A01G517300 chr5B 93.758 769 34 6 1 768 270670446 270669691 0.000000e+00 1142
16 TraesCS7A01G517300 chr5B 77.297 555 95 22 1702 2243 689180330 689179794 4.860000e-77 298
17 TraesCS7A01G517300 chr7B 91.425 758 58 5 1572 2326 700904489 700903736 0.000000e+00 1033
18 TraesCS7A01G517300 chr7B 82.686 618 83 16 1701 2306 701037404 701038009 5.700000e-146 527
19 TraesCS7A01G517300 chr3A 96.332 627 23 0 741 1367 723655155 723655781 0.000000e+00 1031
20 TraesCS7A01G517300 chr3A 98.810 420 5 0 1 420 723654179 723654598 0.000000e+00 749
21 TraesCS7A01G517300 chr3A 93.927 247 12 2 1334 1578 723655782 723656027 1.020000e-98 370
22 TraesCS7A01G517300 chr7D 91.610 739 50 5 1597 2326 611635446 611634711 0.000000e+00 1011
23 TraesCS7A01G517300 chr7D 78.939 622 97 25 1707 2314 611613841 611613240 2.170000e-105 392
24 TraesCS7A01G517300 chr7D 80.488 533 83 14 1701 2230 611661591 611661077 2.800000e-104 388
25 TraesCS7A01G517300 chr7D 85.417 336 30 9 1699 2031 611654070 611653751 4.790000e-87 331
26 TraesCS7A01G517300 chr7D 87.611 226 22 1 1701 1926 611649332 611649113 8.250000e-65 257
27 TraesCS7A01G517300 chr5A 81.266 1185 122 43 420 1574 623005130 623004016 0.000000e+00 867
28 TraesCS7A01G517300 chr5A 89.683 378 27 9 2 376 623005506 623005138 2.710000e-129 472
29 TraesCS7A01G517300 chr1A 80.860 1186 126 43 420 1574 256678674 256677559 0.000000e+00 839
30 TraesCS7A01G517300 chr1A 95.442 373 17 0 1 373 32863387 32863759 1.540000e-166 595
31 TraesCS7A01G517300 chr1D 90.000 190 16 3 1385 1574 468229171 468229357 2.310000e-60 243
32 TraesCS7A01G517300 chr1D 90.000 190 16 3 1385 1574 468232466 468232652 2.310000e-60 243
33 TraesCS7A01G517300 chr1D 74.453 548 100 20 1701 2243 7235369 7235881 1.410000e-47 200
34 TraesCS7A01G517300 chr5D 73.489 513 105 21 1814 2306 546001802 546001301 5.140000e-37 165


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G517300 chr7A 701569831 701572157 2326 True 4298.000000 4298 100.000000 1 2327 1 chr7A.!!$R2 2326
1 TraesCS7A01G517300 chr7A 238817045 238818648 1603 True 1422.000000 2446 97.821500 1 1573 2 chr7A.!!$R4 1572
2 TraesCS7A01G517300 chr7A 29430640 29431753 1113 True 865.000000 865 81.234000 420 1573 1 chr7A.!!$R1 1153
3 TraesCS7A01G517300 chr7A 701620089 701620690 601 True 381.000000 381 78.387000 1701 2314 1 chr7A.!!$R3 613
4 TraesCS7A01G517300 chr4A 547982419 547984024 1605 True 1450.500000 2470 99.217500 1 1573 2 chr4A.!!$R1 1572
5 TraesCS7A01G517300 chr1B 427529870 427530948 1078 False 1550.000000 1550 92.498000 1 1092 1 chr1B.!!$F1 1091
6 TraesCS7A01G517300 chr1B 674376605 674377706 1101 True 878.000000 878 81.437000 423 1572 1 chr1B.!!$R2 1149
7 TraesCS7A01G517300 chr3B 54077222 54078194 972 False 1382.000000 1382 92.269000 1 980 1 chr3B.!!$F1 979
8 TraesCS7A01G517300 chr5B 270669691 270670446 755 True 1142.000000 1142 93.758000 1 768 1 chr5B.!!$R1 767
9 TraesCS7A01G517300 chr5B 689179794 689180330 536 True 298.000000 298 77.297000 1702 2243 1 chr5B.!!$R2 541
10 TraesCS7A01G517300 chr7B 700903736 700904489 753 True 1033.000000 1033 91.425000 1572 2326 1 chr7B.!!$R1 754
11 TraesCS7A01G517300 chr7B 701037404 701038009 605 False 527.000000 527 82.686000 1701 2306 1 chr7B.!!$F1 605
12 TraesCS7A01G517300 chr3A 723654179 723656027 1848 False 716.666667 1031 96.356333 1 1578 3 chr3A.!!$F1 1577
13 TraesCS7A01G517300 chr7D 611634711 611635446 735 True 1011.000000 1011 91.610000 1597 2326 1 chr7D.!!$R2 729
14 TraesCS7A01G517300 chr7D 611613240 611613841 601 True 392.000000 392 78.939000 1707 2314 1 chr7D.!!$R1 607
15 TraesCS7A01G517300 chr7D 611661077 611661591 514 True 388.000000 388 80.488000 1701 2230 1 chr7D.!!$R5 529
16 TraesCS7A01G517300 chr5A 623004016 623005506 1490 True 669.500000 867 85.474500 2 1574 2 chr5A.!!$R1 1572
17 TraesCS7A01G517300 chr1A 256677559 256678674 1115 True 839.000000 839 80.860000 420 1574 1 chr1A.!!$R1 1154
18 TraesCS7A01G517300 chr1D 468229171 468232652 3481 False 243.000000 243 90.000000 1385 1574 2 chr1D.!!$F2 189

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
554 569 1.381928 CCTGCAGCATCCCATGTGTC 61.382 60.0 8.66 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1693 3619 0.901124 GCTGATGTGGTCCTCAGTCT 59.099 55.0 8.09 0.0 40.8 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
453 466 5.451242 GCAGTTTAGTTTTGGAATCCACACA 60.451 40.000 0.00 0.00 30.78 3.72
554 569 1.381928 CCTGCAGCATCCCATGTGTC 61.382 60.000 8.66 0.00 0.00 3.67
1586 3503 6.996879 AGTAGTAGAGATACGTAATTGGCTGA 59.003 38.462 0.00 0.00 0.00 4.26
1609 3526 3.621715 AGCTTACGTAATTAGCAACCTGC 59.378 43.478 17.55 9.82 45.46 4.85
1627 3544 1.512734 CGAGGGGAACGAACGTACG 60.513 63.158 15.01 15.01 39.31 3.67
1628 3545 1.803117 GAGGGGAACGAACGTACGC 60.803 63.158 16.72 0.00 36.70 4.42
1669 3595 2.833582 GGAGTCGAGATCGGGGCA 60.834 66.667 1.91 0.00 40.29 5.36
1674 3600 1.228033 TCGAGATCGGGGCATCGTA 60.228 57.895 1.91 0.00 40.29 3.43
1693 3619 2.038975 CCTCCGTTCCTCCTCCCA 59.961 66.667 0.00 0.00 0.00 4.37
1705 3631 4.874521 CTCCCAGACTGAGGACCA 57.125 61.111 3.32 0.00 0.00 4.02
2162 4094 3.818787 GTCGACTTCCCGGCGCTA 61.819 66.667 8.70 0.00 0.00 4.26
2204 4142 3.593794 GTCCCCGATCTCGACCCG 61.594 72.222 0.22 0.00 43.02 5.28
2253 4191 2.046796 TCCGGCTGCGCAATGTTA 60.047 55.556 13.05 0.00 0.00 2.41
2283 4224 3.386237 ACCTGAGGGTCAGCTCGC 61.386 66.667 2.38 0.00 43.38 5.03
2284 4225 3.073735 CCTGAGGGTCAGCTCGCT 61.074 66.667 0.00 0.00 42.98 4.93
2287 4228 2.125753 GAGGGTCAGCTCGCTGTG 60.126 66.667 17.53 0.00 43.96 3.66
2308 4249 2.883253 GCAGGAGCTCTTCGTCGC 60.883 66.667 14.64 1.53 37.91 5.19
2322 4263 1.962306 GTCGCCCGCTTGTACCAAA 60.962 57.895 0.00 0.00 0.00 3.28
2326 4267 0.891904 GCCCGCTTGTACCAAAGGAA 60.892 55.000 0.00 0.00 0.00 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
554 569 4.827087 AGGCGATGCAGCGTGGAG 62.827 66.667 26.61 0.00 38.18 3.86
1383 1778 2.677979 GCGGACGAAAACTCTGCCC 61.678 63.158 0.00 0.00 34.42 5.36
1586 3503 4.094442 GCAGGTTGCTAATTACGTAAGCTT 59.906 41.667 14.25 3.48 40.96 3.74
1609 3526 1.512734 CGTACGTTCGTTCCCCTCG 60.513 63.158 7.22 0.00 0.00 4.63
1627 3544 1.235724 AGCTCAAAAACCCTACGTGC 58.764 50.000 0.00 0.00 0.00 5.34
1628 3545 2.096417 CGAAGCTCAAAAACCCTACGTG 60.096 50.000 0.00 0.00 0.00 4.49
1669 3595 1.108132 GGAGGAACGGAGGCTACGAT 61.108 60.000 28.69 15.57 34.93 3.73
1674 3600 2.364448 GGAGGAGGAACGGAGGCT 60.364 66.667 0.00 0.00 0.00 4.58
1693 3619 0.901124 GCTGATGTGGTCCTCAGTCT 59.099 55.000 8.09 0.00 40.80 3.24
2204 4142 2.749441 GGGCAGCAGGAGAGCAAC 60.749 66.667 0.00 0.00 36.85 4.17
2249 4187 1.529796 GTCGCCCCCATGGATAACA 59.470 57.895 15.22 0.00 35.39 2.41
2253 4191 3.492353 CAGGTCGCCCCCATGGAT 61.492 66.667 15.22 0.00 35.39 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.