Multiple sequence alignment - TraesCS7A01G505500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G505500 chr7A 100.000 3308 0 0 1 3308 693089344 693086037 0.000000e+00 6109.0
1 TraesCS7A01G505500 chr7A 98.192 3319 47 3 1 3308 693036507 693033191 0.000000e+00 5784.0
2 TraesCS7A01G505500 chr7A 97.923 3322 53 5 1 3308 693062754 693059435 0.000000e+00 5738.0
3 TraesCS7A01G505500 chr7A 93.857 2849 86 25 83 2860 693134766 693131936 0.000000e+00 4209.0
4 TraesCS7A01G505500 chr7D 93.811 2763 111 22 590 3307 601391960 601389213 0.000000e+00 4100.0
5 TraesCS7A01G505500 chr7D 72.686 1329 288 53 991 2286 601494375 601493089 1.120000e-99 374.0
6 TraesCS7A01G505500 chr7D 79.764 509 55 28 45 543 601392429 601391959 3.180000e-85 326.0
7 TraesCS7A01G505500 chr7D 74.380 847 178 30 1359 2193 601439282 601438463 3.180000e-85 326.0
8 TraesCS7A01G505500 chr7B 93.570 1804 93 10 478 2279 680351496 680349714 0.000000e+00 2667.0
9 TraesCS7A01G505500 chr7B 89.459 1053 78 17 2274 3307 680349669 680348631 0.000000e+00 1299.0
10 TraesCS7A01G505500 chr7B 84.752 787 101 6 1499 2284 680369914 680369146 0.000000e+00 771.0
11 TraesCS7A01G505500 chr7B 84.030 670 69 16 2638 3297 680364278 680363637 7.850000e-171 610.0
12 TraesCS7A01G505500 chr7B 89.752 322 33 0 1180 1501 680382029 680381708 2.380000e-111 412.0
13 TraesCS7A01G505500 chr7B 72.915 1259 273 48 991 2218 680854467 680853246 1.120000e-99 374.0
14 TraesCS7A01G505500 chr7B 90.391 281 25 2 150 429 680351790 680351511 5.220000e-98 368.0
15 TraesCS7A01G505500 chr7B 84.119 403 36 10 654 1046 680408169 680407785 6.750000e-97 364.0
16 TraesCS7A01G505500 chr7B 82.734 417 44 10 654 1060 680439517 680439119 2.440000e-91 346.0
17 TraesCS7A01G505500 chr7B 77.228 606 113 14 1620 2222 600721130 600721713 6.840000e-87 331.0
18 TraesCS7A01G505500 chr7B 81.055 417 43 10 654 1060 680468106 680467716 1.930000e-77 300.0
19 TraesCS7A01G505500 chr7B 83.182 220 14 8 45 243 680468460 680468243 2.620000e-41 180.0
20 TraesCS7A01G505500 chr7B 88.636 88 4 1 229 310 680468226 680468139 5.840000e-18 102.0
21 TraesCS7A01G505500 chr3D 85.005 1047 119 21 2275 3302 11144084 11143057 0.000000e+00 1029.0
22 TraesCS7A01G505500 chr3A 84.515 1001 116 16 2275 3252 18780319 18779335 0.000000e+00 953.0
23 TraesCS7A01G505500 chr3A 83.270 1052 131 24 2275 3302 18168135 18167105 0.000000e+00 926.0
24 TraesCS7A01G505500 chr2D 72.193 1327 286 59 991 2280 33544544 33545824 2.460000e-86 329.0
25 TraesCS7A01G505500 chr2D 71.847 1332 288 63 991 2280 33340688 33341974 5.360000e-78 302.0
26 TraesCS7A01G505500 chr2D 89.362 47 4 1 45 91 8278949 8278904 1.280000e-04 58.4
27 TraesCS7A01G505500 chr3B 82.724 301 39 6 2274 2566 25665242 25664947 4.240000e-64 255.0
28 TraesCS7A01G505500 chr3B 82.450 302 39 8 2274 2566 15761981 15762277 5.480000e-63 252.0
29 TraesCS7A01G505500 chr3B 89.691 194 19 1 2092 2284 15728171 15728364 2.550000e-61 246.0
30 TraesCS7A01G505500 chr6D 92.000 50 2 2 45 93 411617745 411617793 5.920000e-08 69.4
31 TraesCS7A01G505500 chr1D 91.667 48 3 1 45 92 320172894 320172940 7.660000e-07 65.8
32 TraesCS7A01G505500 chr6A 91.489 47 3 1 45 91 609593053 609593098 2.760000e-06 63.9
33 TraesCS7A01G505500 chr2B 91.489 47 3 1 45 91 17398905 17398950 2.760000e-06 63.9
34 TraesCS7A01G505500 chr2B 83.871 62 8 2 45 105 330071750 330071690 1.280000e-04 58.4
35 TraesCS7A01G505500 chr2A 89.362 47 4 1 45 91 48408559 48408514 1.280000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G505500 chr7A 693086037 693089344 3307 True 6109.000000 6109 100.0000 1 3308 1 chr7A.!!$R3 3307
1 TraesCS7A01G505500 chr7A 693033191 693036507 3316 True 5784.000000 5784 98.1920 1 3308 1 chr7A.!!$R1 3307
2 TraesCS7A01G505500 chr7A 693059435 693062754 3319 True 5738.000000 5738 97.9230 1 3308 1 chr7A.!!$R2 3307
3 TraesCS7A01G505500 chr7A 693131936 693134766 2830 True 4209.000000 4209 93.8570 83 2860 1 chr7A.!!$R4 2777
4 TraesCS7A01G505500 chr7D 601389213 601392429 3216 True 2213.000000 4100 86.7875 45 3307 2 chr7D.!!$R3 3262
5 TraesCS7A01G505500 chr7D 601493089 601494375 1286 True 374.000000 374 72.6860 991 2286 1 chr7D.!!$R2 1295
6 TraesCS7A01G505500 chr7D 601438463 601439282 819 True 326.000000 326 74.3800 1359 2193 1 chr7D.!!$R1 834
7 TraesCS7A01G505500 chr7B 680348631 680351790 3159 True 1444.666667 2667 91.1400 150 3307 3 chr7B.!!$R7 3157
8 TraesCS7A01G505500 chr7B 680369146 680369914 768 True 771.000000 771 84.7520 1499 2284 1 chr7B.!!$R2 785
9 TraesCS7A01G505500 chr7B 680363637 680364278 641 True 610.000000 610 84.0300 2638 3297 1 chr7B.!!$R1 659
10 TraesCS7A01G505500 chr7B 680853246 680854467 1221 True 374.000000 374 72.9150 991 2218 1 chr7B.!!$R6 1227
11 TraesCS7A01G505500 chr7B 600721130 600721713 583 False 331.000000 331 77.2280 1620 2222 1 chr7B.!!$F1 602
12 TraesCS7A01G505500 chr3D 11143057 11144084 1027 True 1029.000000 1029 85.0050 2275 3302 1 chr3D.!!$R1 1027
13 TraesCS7A01G505500 chr3A 18779335 18780319 984 True 953.000000 953 84.5150 2275 3252 1 chr3A.!!$R2 977
14 TraesCS7A01G505500 chr3A 18167105 18168135 1030 True 926.000000 926 83.2700 2275 3302 1 chr3A.!!$R1 1027
15 TraesCS7A01G505500 chr2D 33544544 33545824 1280 False 329.000000 329 72.1930 991 2280 1 chr2D.!!$F2 1289
16 TraesCS7A01G505500 chr2D 33340688 33341974 1286 False 302.000000 302 71.8470 991 2280 1 chr2D.!!$F1 1289

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
735 806 1.522580 GTTGGGGCTCAGATCTCGC 60.523 63.158 0.0 0.0 0.00 5.03 F
1075 1157 1.618837 ACAGCATACTCGTCCTGTTGT 59.381 47.619 0.0 0.0 35.14 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2230 2360 3.626028 ACCAGAAGTCGCAAACATTTC 57.374 42.857 0.0 0.0 0.00 2.17 R
2966 3211 1.200020 GAATTGCGGAGGTCCAGTTTG 59.800 52.381 0.0 0.0 35.14 2.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
305 323 1.971505 ATTTCCAGATCTCGCCGGCA 61.972 55.000 28.98 12.94 0.00 5.69
735 806 1.522580 GTTGGGGCTCAGATCTCGC 60.523 63.158 0.00 0.00 0.00 5.03
1075 1157 1.618837 ACAGCATACTCGTCCTGTTGT 59.381 47.619 0.00 0.00 35.14 3.32
1170 1252 2.824041 GAACACCATCGCCGCCAT 60.824 61.111 0.00 0.00 0.00 4.40
1562 1668 4.139786 AGACATGTCACAGTGAAAATGCT 58.860 39.130 27.02 16.46 33.50 3.79
2128 2249 6.183360 GGTGAACATTGGGAAGAGTCAATATG 60.183 42.308 0.00 0.00 32.92 1.78
2230 2360 3.801698 CCTCCATTCATAGGGCATATCG 58.198 50.000 0.00 0.00 0.00 2.92
2304 2484 1.144708 TGGATGGTTGAGGACTTGCAA 59.855 47.619 0.00 0.00 0.00 4.08
2992 3237 1.291132 GACCTCCGCAATTCTACTGC 58.709 55.000 0.00 0.00 36.41 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 197 5.063691 AGTGTTCTCTTATGACGAGTCTACG 59.936 44.000 4.78 0.00 39.31 3.51
263 274 4.120589 GAGAAACAATTAGGGCCTCTACG 58.879 47.826 10.74 0.00 0.00 3.51
305 323 2.264794 GACACGATCCGGCAAGGT 59.735 61.111 0.00 0.00 41.99 3.50
455 474 4.174009 CGAAGAAAGAGGCGAACTTGATA 58.826 43.478 0.00 0.00 0.00 2.15
735 806 1.202627 GCCTCTCTGCAGGAATACAGG 60.203 57.143 15.13 10.86 35.20 4.00
980 1062 0.321653 GGTGCTCCGTTGGACTGAAT 60.322 55.000 0.00 0.00 0.00 2.57
1170 1252 2.443952 ATGATGGGGAGCGACGGA 60.444 61.111 0.00 0.00 0.00 4.69
1562 1668 4.338400 CCACATAAGATGACAGGACGACTA 59.662 45.833 0.00 0.00 0.00 2.59
2230 2360 3.626028 ACCAGAAGTCGCAAACATTTC 57.374 42.857 0.00 0.00 0.00 2.17
2403 2584 3.679980 GCAGCGATGAACAGTAGAAAAGA 59.320 43.478 4.02 0.00 0.00 2.52
2582 2790 4.083696 GCTTTGACCAAATTGCATTCCAAG 60.084 41.667 0.00 0.00 36.76 3.61
2966 3211 1.200020 GAATTGCGGAGGTCCAGTTTG 59.800 52.381 0.00 0.00 35.14 2.93
2992 3237 5.060569 CGTCACTTTAGTTACATGGACGAAG 59.939 44.000 10.75 11.19 46.89 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.