Multiple sequence alignment - TraesCS7A01G497000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G497000 chr7A 100.000 2594 0 0 1 2594 686715716 686713123 0.000000e+00 4791
1 TraesCS7A01G497000 chr7A 97.187 2595 67 4 1 2594 686650813 686648224 0.000000e+00 4383
2 TraesCS7A01G497000 chr7A 98.913 2299 25 0 1 2299 686740184 686737886 0.000000e+00 4108
3 TraesCS7A01G497000 chr7A 90.000 170 15 2 2427 2594 686589640 686589471 4.350000e-53 219
4 TraesCS7A01G497000 chr7D 97.083 2434 64 5 1 2431 381973802 381971373 0.000000e+00 4095
5 TraesCS7A01G497000 chr7D 96.795 2434 69 4 1 2431 203499964 203502391 0.000000e+00 4054
6 TraesCS7A01G497000 chr7B 96.781 2423 71 3 1 2421 742989411 742991828 0.000000e+00 4036
7 TraesCS7A01G497000 chr4D 96.506 2433 76 4 1 2431 123335438 123337863 0.000000e+00 4013
8 TraesCS7A01G497000 chr4D 96.610 2419 77 4 1 2416 123549891 123552307 0.000000e+00 4008
9 TraesCS7A01G497000 chr6D 95.813 2436 97 4 1 2431 168755055 168757490 0.000000e+00 3928
10 TraesCS7A01G497000 chr6D 95.429 525 17 2 1908 2431 168757764 168758282 0.000000e+00 830
11 TraesCS7A01G497000 chrUn 97.311 2306 59 3 1 2305 339523437 339525740 0.000000e+00 3912
12 TraesCS7A01G497000 chrUn 97.225 2306 61 3 1 2305 339526004 339528307 0.000000e+00 3901
13 TraesCS7A01G497000 chr3B 95.378 2423 103 5 1 2421 797592969 797590554 0.000000e+00 3845


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G497000 chr7A 686713123 686715716 2593 True 4791.0 4791 100.000 1 2594 1 chr7A.!!$R3 2593
1 TraesCS7A01G497000 chr7A 686648224 686650813 2589 True 4383.0 4383 97.187 1 2594 1 chr7A.!!$R2 2593
2 TraesCS7A01G497000 chr7A 686737886 686740184 2298 True 4108.0 4108 98.913 1 2299 1 chr7A.!!$R4 2298
3 TraesCS7A01G497000 chr7D 381971373 381973802 2429 True 4095.0 4095 97.083 1 2431 1 chr7D.!!$R1 2430
4 TraesCS7A01G497000 chr7D 203499964 203502391 2427 False 4054.0 4054 96.795 1 2431 1 chr7D.!!$F1 2430
5 TraesCS7A01G497000 chr7B 742989411 742991828 2417 False 4036.0 4036 96.781 1 2421 1 chr7B.!!$F1 2420
6 TraesCS7A01G497000 chr4D 123335438 123337863 2425 False 4013.0 4013 96.506 1 2431 1 chr4D.!!$F1 2430
7 TraesCS7A01G497000 chr4D 123549891 123552307 2416 False 4008.0 4008 96.610 1 2416 1 chr4D.!!$F2 2415
8 TraesCS7A01G497000 chr6D 168755055 168758282 3227 False 2379.0 3928 95.621 1 2431 2 chr6D.!!$F1 2430
9 TraesCS7A01G497000 chrUn 339523437 339528307 4870 False 3906.5 3912 97.268 1 2305 2 chrUn.!!$F1 2304
10 TraesCS7A01G497000 chr3B 797590554 797592969 2415 True 3845.0 3845 95.378 1 2421 1 chr3B.!!$R1 2420

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
762 766 1.302511 GTGTGGAATGGCCGACAGT 60.303 57.895 0.0 0.0 40.66 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2327 5707 0.685131 CCCTCTGCCATCCATTGCAA 60.685 55.0 0.0 0.0 36.98 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 1.689932 TTCCCCGAAGCCCCGAATA 60.690 57.895 0.00 0.0 0.00 1.75
162 163 1.988846 CCCCTCCCTCTGTCTTTTTCT 59.011 52.381 0.00 0.0 0.00 2.52
438 441 5.985530 CGACTTTCAGATAAGGTGCATATCA 59.014 40.000 8.20 0.0 33.17 2.15
759 763 3.799755 GCGTGTGGAATGGCCGAC 61.800 66.667 0.00 0.0 40.66 4.79
762 766 1.302511 GTGTGGAATGGCCGACAGT 60.303 57.895 0.00 0.0 40.66 3.55
1564 1570 7.011202 CAGTGAGAGTAGTGACTAGCGTTATAA 59.989 40.741 0.00 0.0 35.45 0.98
2326 5706 0.179111 CCGCTCATGAAACGGCTCTA 60.179 55.000 20.28 0.0 40.55 2.43
2327 5707 1.539065 CCGCTCATGAAACGGCTCTAT 60.539 52.381 20.28 0.0 40.55 1.98
2504 5884 2.036346 TCATCCATATCAGCGTCCTGTG 59.964 50.000 0.00 0.0 40.09 3.66
2531 5911 4.974438 TCCCAGGCCGGTCACCTT 62.974 66.667 9.71 0.0 34.42 3.50
2553 5933 2.292267 CAATGCCATTCTTCTACGGCT 58.708 47.619 0.00 0.0 45.13 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 3.937706 CAGAAGCAGAAACGATCCAATCT 59.062 43.478 0.00 0.00 0.00 2.40
162 163 2.578021 AGAGGGGAAGATTAGCAAAGCA 59.422 45.455 0.00 0.00 0.00 3.91
338 341 2.293586 TGTTTGGAGGGGTCCTAGCTAT 60.294 50.000 0.00 0.00 31.76 2.97
438 441 4.562963 CGAGCCTTTCCTTTAGTGGTAAGT 60.563 45.833 0.00 0.00 34.13 2.24
1843 1849 1.227321 GTCGTTCCAACCACCGACA 60.227 57.895 6.20 0.00 46.53 4.35
2308 5688 1.858091 ATAGAGCCGTTTCATGAGCG 58.142 50.000 12.83 12.83 0.00 5.03
2326 5706 1.410004 CCTCTGCCATCCATTGCAAT 58.590 50.000 5.99 5.99 36.98 3.56
2327 5707 0.685131 CCCTCTGCCATCCATTGCAA 60.685 55.000 0.00 0.00 36.98 4.08
2504 5884 1.677637 CGGCCTGGGAAGAGGACTAC 61.678 65.000 0.00 0.00 39.32 2.73
2531 5911 2.917933 CCGTAGAAGAATGGCATTGGA 58.082 47.619 19.07 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.