Multiple sequence alignment - TraesCS7A01G496800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G496800 chr7A 100.000 2594 0 0 1 2594 686650815 686648222 0.000000e+00 4791
1 TraesCS7A01G496800 chr7A 97.189 2597 67 4 3 2594 686715716 686713121 0.000000e+00 4386
2 TraesCS7A01G496800 chr7A 90.698 172 14 2 2425 2594 686589640 686589469 7.220000e-56 228
3 TraesCS7A01G496800 chrUn 99.350 2306 15 0 1 2306 339523435 339525740 0.000000e+00 4176
4 TraesCS7A01G496800 chr5A 97.207 2435 58 6 1 2429 19248881 19246451 0.000000e+00 4111
5 TraesCS7A01G496800 chr7D 97.126 2436 59 7 1 2429 381973804 381971373 0.000000e+00 4100
6 TraesCS7A01G496800 chr7D 97.125 2435 60 6 1 2429 382050041 382052471 0.000000e+00 4100
7 TraesCS7A01G496800 chr7D 97.124 2434 61 6 1 2429 381923964 381926393 0.000000e+00 4098
8 TraesCS7A01G496800 chr7D 97.042 2434 63 6 1 2429 203499962 203502391 0.000000e+00 4087
9 TraesCS7A01G496800 chr6D 96.960 2434 65 6 1 2429 124517485 124519914 0.000000e+00 4076
10 TraesCS7A01G496800 chr4D 96.876 2433 67 7 1 2429 123335436 123337863 0.000000e+00 4063


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G496800 chr7A 686648222 686650815 2593 True 4791 4791 100.000 1 2594 1 chr7A.!!$R2 2593
1 TraesCS7A01G496800 chr7A 686713121 686715716 2595 True 4386 4386 97.189 3 2594 1 chr7A.!!$R3 2591
2 TraesCS7A01G496800 chrUn 339523435 339525740 2305 False 4176 4176 99.350 1 2306 1 chrUn.!!$F1 2305
3 TraesCS7A01G496800 chr5A 19246451 19248881 2430 True 4111 4111 97.207 1 2429 1 chr5A.!!$R1 2428
4 TraesCS7A01G496800 chr7D 381971373 381973804 2431 True 4100 4100 97.126 1 2429 1 chr7D.!!$R1 2428
5 TraesCS7A01G496800 chr7D 382050041 382052471 2430 False 4100 4100 97.125 1 2429 1 chr7D.!!$F3 2428
6 TraesCS7A01G496800 chr7D 381923964 381926393 2429 False 4098 4098 97.124 1 2429 1 chr7D.!!$F2 2428
7 TraesCS7A01G496800 chr7D 203499962 203502391 2429 False 4087 4087 97.042 1 2429 1 chr7D.!!$F1 2428
8 TraesCS7A01G496800 chr6D 124517485 124519914 2429 False 4076 4076 96.960 1 2429 1 chr6D.!!$F1 2428
9 TraesCS7A01G496800 chr4D 123335436 123337863 2427 False 4063 4063 96.876 1 2429 1 chr4D.!!$F1 2428

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
763 768 1.003839 GTGTGGAATGGCCGAGACA 60.004 57.895 0.0 0.0 40.66 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2502 2516 0.760945 CGGCCTGGGAAGAGGACTAT 60.761 60.0 0.0 0.0 39.32 2.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 2.557924 TGCTTCTGCCAACGAAATGAAT 59.442 40.909 0.00 0.0 38.71 2.57
123 124 2.165234 CTCTGATCCTGAAGTTCTCGCA 59.835 50.000 4.17 0.0 0.00 5.10
762 767 2.100631 CGTGTGGAATGGCCGAGAC 61.101 63.158 0.00 0.0 40.66 3.36
763 768 1.003839 GTGTGGAATGGCCGAGACA 60.004 57.895 0.00 0.0 40.66 3.41
891 896 6.004574 AGAATAAGTCCTTCCCTTTTGTGTC 58.995 40.000 0.00 0.0 0.00 3.67
943 952 4.538089 GGGGCCCTATCTATTCAATCTCTT 59.462 45.833 24.38 0.0 0.00 2.85
950 960 5.901413 ATCTATTCAATCTCTTGAGCCCA 57.099 39.130 0.00 0.0 42.19 5.36
2502 2516 3.496331 TCATCCATATCAGCGTCCTGTA 58.504 45.455 0.00 0.0 40.09 2.74
2551 2565 1.334869 CAATGCCATTCTTCTACGGCC 59.665 52.381 0.00 0.0 44.22 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 1.923395 ATTCGGAAGGGGTGAGGCA 60.923 57.895 0.00 0.00 0.00 4.75
123 124 4.385754 GGGGAGGTGCATCTTATTCTCTTT 60.386 45.833 0.00 0.00 0.00 2.52
532 537 2.239400 CCCTCGGCCTTCTTTCTTTTT 58.761 47.619 0.00 0.00 0.00 1.94
943 952 0.471022 GGGGGTTTTCTTTGGGCTCA 60.471 55.000 0.00 0.00 0.00 4.26
1339 1349 2.745152 GCCGTAATGCTGGAACTATGGT 60.745 50.000 0.00 0.00 0.00 3.55
2306 2317 1.986575 GCAGAGCCGTTTCATGAGCC 61.987 60.000 0.00 0.00 0.00 4.70
2502 2516 0.760945 CGGCCTGGGAAGAGGACTAT 60.761 60.000 0.00 0.00 39.32 2.12
2529 2543 1.949525 CCGTAGAAGAATGGCATTGGG 59.050 52.381 19.07 3.47 0.00 4.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.