Multiple sequence alignment - TraesCS7A01G488100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G488100 chr7A 100.000 2407 0 0 1 2407 678174579 678172173 0.000000e+00 4446
1 TraesCS7A01G488100 chr2A 96.672 2434 50 8 1 2407 721732073 721734502 0.000000e+00 4017
2 TraesCS7A01G488100 chr2A 96.211 1346 43 6 1 1342 195109722 195111063 0.000000e+00 2196
3 TraesCS7A01G488100 chr2A 98.186 882 14 2 1527 2407 195111506 195112386 0.000000e+00 1539
4 TraesCS7A01G488100 chr2A 91.964 336 6 1 1331 1645 195111102 195111437 3.650000e-123 451
5 TraesCS7A01G488100 chr2A 93.000 100 7 0 491 590 593027093 593027192 1.930000e-31 147
6 TraesCS7A01G488100 chr5D 94.144 2459 72 18 1 2407 254536172 254533734 0.000000e+00 3677
7 TraesCS7A01G488100 chr5D 95.848 1710 33 7 724 2407 551022179 551020482 0.000000e+00 2730
8 TraesCS7A01G488100 chr5D 96.226 318 11 1 1 317 551022503 551022186 9.860000e-144 520
9 TraesCS7A01G488100 chr7D 95.154 1878 36 7 579 2407 509916242 509914371 0.000000e+00 2913
10 TraesCS7A01G488100 chr7D 95.200 500 21 2 1 499 509916739 509916242 0.000000e+00 787
11 TraesCS7A01G488100 chr7D 92.929 99 7 0 488 586 481573848 481573750 6.940000e-31 145
12 TraesCS7A01G488100 chr7D 87.395 119 9 6 490 607 34845648 34845535 5.400000e-27 132
13 TraesCS7A01G488100 chr1B 93.636 1697 49 16 1 1645 154144852 154146541 0.000000e+00 2481
14 TraesCS7A01G488100 chr1B 98.073 882 15 2 1527 2407 154146610 154147490 0.000000e+00 1533
15 TraesCS7A01G488100 chr1B 88.415 656 46 15 1332 1963 55537512 55536863 0.000000e+00 763
16 TraesCS7A01G488100 chr1B 88.789 446 30 7 1978 2407 55536878 55536437 1.640000e-146 529
17 TraesCS7A01G488100 chr4D 95.911 1345 52 3 1 1342 40828431 40829775 0.000000e+00 2176
18 TraesCS7A01G488100 chr4D 96.858 923 13 5 1486 2407 40829854 40830761 0.000000e+00 1530
19 TraesCS7A01G488100 chr4D 86.744 943 78 22 1331 2260 315817600 315818508 0.000000e+00 1005
20 TraesCS7A01G488100 chr4D 85.580 742 92 8 594 1333 315816823 315817551 0.000000e+00 763
21 TraesCS7A01G488100 chr1A 95.768 1347 47 6 1 1342 14531709 14530368 0.000000e+00 2163
22 TraesCS7A01G488100 chr1A 96.455 1100 16 10 1331 2407 14530329 14529230 0.000000e+00 1794
23 TraesCS7A01G488100 chr1A 84.556 259 32 7 245 499 45631754 45632008 1.430000e-62 250
24 TraesCS7A01G488100 chr1D 88.838 654 42 15 1332 1960 479501991 479502638 0.000000e+00 774
25 TraesCS7A01G488100 chrUn 88.432 657 45 15 1332 1963 260016886 260016236 0.000000e+00 763
26 TraesCS7A01G488100 chrUn 100.000 253 0 0 2155 2407 480831436 480831184 3.620000e-128 468
27 TraesCS7A01G488100 chr3A 91.304 322 21 4 1 317 365957252 365956933 1.320000e-117 433
28 TraesCS7A01G488100 chr4B 86.538 260 27 7 245 499 566607150 566607406 1.820000e-71 279


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G488100 chr7A 678172173 678174579 2406 True 4446.000000 4446 100.000000 1 2407 1 chr7A.!!$R1 2406
1 TraesCS7A01G488100 chr2A 721732073 721734502 2429 False 4017.000000 4017 96.672000 1 2407 1 chr2A.!!$F2 2406
2 TraesCS7A01G488100 chr2A 195109722 195112386 2664 False 1395.333333 2196 95.453667 1 2407 3 chr2A.!!$F3 2406
3 TraesCS7A01G488100 chr5D 254533734 254536172 2438 True 3677.000000 3677 94.144000 1 2407 1 chr5D.!!$R1 2406
4 TraesCS7A01G488100 chr5D 551020482 551022503 2021 True 1625.000000 2730 96.037000 1 2407 2 chr5D.!!$R2 2406
5 TraesCS7A01G488100 chr7D 509914371 509916739 2368 True 1850.000000 2913 95.177000 1 2407 2 chr7D.!!$R3 2406
6 TraesCS7A01G488100 chr1B 154144852 154147490 2638 False 2007.000000 2481 95.854500 1 2407 2 chr1B.!!$F1 2406
7 TraesCS7A01G488100 chr1B 55536437 55537512 1075 True 646.000000 763 88.602000 1332 2407 2 chr1B.!!$R1 1075
8 TraesCS7A01G488100 chr4D 40828431 40830761 2330 False 1853.000000 2176 96.384500 1 2407 2 chr4D.!!$F1 2406
9 TraesCS7A01G488100 chr4D 315816823 315818508 1685 False 884.000000 1005 86.162000 594 2260 2 chr4D.!!$F2 1666
10 TraesCS7A01G488100 chr1A 14529230 14531709 2479 True 1978.500000 2163 96.111500 1 2407 2 chr1A.!!$R1 2406
11 TraesCS7A01G488100 chr1D 479501991 479502638 647 False 774.000000 774 88.838000 1332 1960 1 chr1D.!!$F1 628
12 TraesCS7A01G488100 chrUn 260016236 260016886 650 True 763.000000 763 88.432000 1332 1963 1 chrUn.!!$R1 631

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
888 990 0.46729 GTCATCTCTCCCTCTCGCCT 60.467 60.0 0.0 0.0 0.0 5.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2062 2649 4.580167 GCATTACTCCTGCCATGATAACAA 59.42 41.667 0.0 0.0 33.44 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
396 414 4.576873 TGAAGGACTTAAAATGTGCAACGA 59.423 37.500 0.0 0.0 42.39 3.85
506 606 7.127339 TGCATTTCCTAAATTAGTACTCCCTCT 59.873 37.037 0.0 0.0 0.00 3.69
682 783 6.604930 ACGTTACAAAATTCTATGGTTTCCG 58.395 36.000 0.0 0.0 0.00 4.30
702 803 1.605753 GTTTTTCCCCTCGCTCACTT 58.394 50.000 0.0 0.0 0.00 3.16
771 873 1.852965 CCCACTCCACCAAATCCCTAT 59.147 52.381 0.0 0.0 0.00 2.57
873 975 1.153745 GCCTTCTCGTCTGCGTCAT 60.154 57.895 0.0 0.0 39.49 3.06
888 990 0.467290 GTCATCTCTCCCTCTCGCCT 60.467 60.000 0.0 0.0 0.00 5.52
1086 1188 2.352032 GCTGCTGGTACTCCTCCGT 61.352 63.158 0.0 0.0 34.23 4.69
1111 1213 3.170672 AGTGCCCTGTCACCTGCA 61.171 61.111 0.0 0.0 37.68 4.41
1196 1298 2.576191 CCCCACACCTTTCCAATCTCTA 59.424 50.000 0.0 0.0 0.00 2.43
2062 2649 4.711846 TGTGATCATGGAGTAGTTAGCTGT 59.288 41.667 0.0 0.0 0.00 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
10 11 2.779430 TCCAATCATACAGGGATGCAGT 59.221 45.455 0.00 0.0 0.00 4.40
396 414 6.005198 TCCGGTTAACACCATGAGTATTTTT 58.995 36.000 8.10 0.0 44.53 1.94
425 443 6.547510 GCTCTGGTGGAATGGTAAAGAATTAT 59.452 38.462 0.00 0.0 0.00 1.28
506 606 9.695526 TTCTAAACGCTCTTGTATTAGTTTACA 57.304 29.630 0.00 0.0 34.29 2.41
682 783 0.250770 AGTGAGCGAGGGGAAAAACC 60.251 55.000 0.00 0.0 38.08 3.27
702 803 0.190069 ACTGGGTGAGTGGGTGAGTA 59.810 55.000 0.00 0.0 31.75 2.59
873 975 2.441164 GCAGGCGAGAGGGAGAGA 60.441 66.667 0.00 0.0 0.00 3.10
888 990 3.963687 CTGTGGCGCTGAGGATGCA 62.964 63.158 7.64 0.0 0.00 3.96
1086 1188 2.675423 ACAGGGCACTCGTAGCGA 60.675 61.111 0.00 0.0 0.00 4.93
1123 1225 3.760035 GGGGAGCTCGACTTCGCA 61.760 66.667 7.83 0.0 36.81 5.10
1196 1298 0.264955 TTCCCCGAATCCTAGGCTCT 59.735 55.000 2.96 0.0 0.00 4.09
2062 2649 4.580167 GCATTACTCCTGCCATGATAACAA 59.420 41.667 0.00 0.0 33.44 2.83
2143 2731 7.721842 TGAAACCATGTACTATTCCTCACAAAA 59.278 33.333 0.00 0.0 0.00 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.