Multiple sequence alignment - TraesCS7A01G486400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G486400 chr7A 100.000 2455 0 0 1 2455 676837841 676835387 0.000000e+00 4534
1 TraesCS7A01G486400 chr7A 98.673 1960 24 1 496 2455 676810527 676808570 0.000000e+00 3474
2 TraesCS7A01G486400 chr7A 95.992 1971 72 5 490 2455 358383028 358384996 0.000000e+00 3195
3 TraesCS7A01G486400 chr7A 96.316 1927 65 4 533 2455 676724486 676722562 0.000000e+00 3160
4 TraesCS7A01G486400 chr7A 93.979 1229 59 5 562 1776 104383505 104382278 0.000000e+00 1845
5 TraesCS7A01G486400 chr7A 97.063 681 20 0 1775 2455 387941503 387942183 0.000000e+00 1147
6 TraesCS7A01G486400 chr7A 97.160 493 14 0 4 496 676725354 676724862 0.000000e+00 833
7 TraesCS7A01G486400 chr7A 96.143 363 14 0 6 368 104384263 104383901 5.850000e-166 593
8 TraesCS7A01G486400 chr6A 95.635 1970 81 3 490 2455 82806953 82804985 0.000000e+00 3157
9 TraesCS7A01G486400 chr5A 95.436 1972 82 6 491 2455 75980356 75978386 0.000000e+00 3136
10 TraesCS7A01G486400 chr1A 95.831 1919 74 4 490 2403 579141539 579139622 0.000000e+00 3096
11 TraesCS7A01G486400 chr2A 95.596 1930 78 4 531 2455 274139193 274141120 0.000000e+00 3086
12 TraesCS7A01G486400 chr2A 95.985 523 16 5 6 526 274138386 274138905 0.000000e+00 845
13 TraesCS7A01G486400 chr2A 95.455 352 16 0 6 357 547862128 547862479 1.650000e-156 562
14 TraesCS7A01G486400 chr3A 94.926 1971 87 4 490 2455 644406977 644405015 0.000000e+00 3073
15 TraesCS7A01G486400 chr5B 94.008 484 26 3 6 488 629218396 629217915 0.000000e+00 730
16 TraesCS7A01G486400 chr1D 90.438 502 24 4 6 485 262483574 262484073 7.400000e-180 640
17 TraesCS7A01G486400 chr7B 91.023 479 20 3 6 462 750372534 750372057 2.070000e-175 625
18 TraesCS7A01G486400 chr3B 91.827 416 25 5 6 416 725603993 725604404 2.740000e-159 571
19 TraesCS7A01G486400 chr3B 89.423 416 32 8 6 413 413311485 413311896 4.680000e-142 514


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G486400 chr7A 676835387 676837841 2454 True 4534.0 4534 100.0000 1 2455 1 chr7A.!!$R2 2454
1 TraesCS7A01G486400 chr7A 676808570 676810527 1957 True 3474.0 3474 98.6730 496 2455 1 chr7A.!!$R1 1959
2 TraesCS7A01G486400 chr7A 358383028 358384996 1968 False 3195.0 3195 95.9920 490 2455 1 chr7A.!!$F1 1965
3 TraesCS7A01G486400 chr7A 676722562 676725354 2792 True 1996.5 3160 96.7380 4 2455 2 chr7A.!!$R4 2451
4 TraesCS7A01G486400 chr7A 104382278 104384263 1985 True 1219.0 1845 95.0610 6 1776 2 chr7A.!!$R3 1770
5 TraesCS7A01G486400 chr7A 387941503 387942183 680 False 1147.0 1147 97.0630 1775 2455 1 chr7A.!!$F2 680
6 TraesCS7A01G486400 chr6A 82804985 82806953 1968 True 3157.0 3157 95.6350 490 2455 1 chr6A.!!$R1 1965
7 TraesCS7A01G486400 chr5A 75978386 75980356 1970 True 3136.0 3136 95.4360 491 2455 1 chr5A.!!$R1 1964
8 TraesCS7A01G486400 chr1A 579139622 579141539 1917 True 3096.0 3096 95.8310 490 2403 1 chr1A.!!$R1 1913
9 TraesCS7A01G486400 chr2A 274138386 274141120 2734 False 1965.5 3086 95.7905 6 2455 2 chr2A.!!$F2 2449
10 TraesCS7A01G486400 chr3A 644405015 644406977 1962 True 3073.0 3073 94.9260 490 2455 1 chr3A.!!$R1 1965

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
680 1020 0.179073 CGCCAATCAGGACCTCGATT 60.179 55.0 11.3 11.3 41.22 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2065 2421 5.00911 AGAGAAGAAAGCAAAAGTAACCAGC 59.991 40.0 0.0 0.0 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 4.938832 CCGTCCATAAAATGTGGTCTAACA 59.061 41.667 0.00 0.0 37.96 2.41
154 155 4.593956 GAACCAATCAGAACCCTTCTCAT 58.406 43.478 0.00 0.0 38.11 2.90
268 269 1.546773 CCACTCCTCTCCCCTCTATCG 60.547 61.905 0.00 0.0 0.00 2.92
305 306 3.077556 CAGCCGCCACCTACCTCT 61.078 66.667 0.00 0.0 0.00 3.69
311 312 2.042843 CCACCTACCTCTCGCCCT 60.043 66.667 0.00 0.0 0.00 5.19
416 417 2.584418 CCTGATGCCTCACTCGCG 60.584 66.667 0.00 0.0 0.00 5.87
680 1020 0.179073 CGCCAATCAGGACCTCGATT 60.179 55.000 11.30 11.3 41.22 3.34
758 1098 2.887738 ATTCGGCCCTCAGCTCCTCT 62.888 60.000 0.00 0.0 43.05 3.69
884 1226 3.189910 CGCCTGTCTATATAAGGTACGCA 59.810 47.826 1.77 0.0 33.34 5.24
1086 1437 2.484062 GCCCATCGCCAACATCAGG 61.484 63.158 0.00 0.0 0.00 3.86
1215 1566 1.367471 CCTCTGTTGACCGCTGACA 59.633 57.895 0.00 0.0 0.00 3.58
1350 1701 3.069980 ATCGACGACCTGCTCTGGC 62.070 63.158 0.00 0.0 39.26 4.85
1642 1996 3.953612 GGCACCAATCATCTTATTGTCCA 59.046 43.478 0.00 0.0 35.48 4.02
2065 2421 5.127845 ACTTGATCACCACACCTCTACTATG 59.872 44.000 0.00 0.0 0.00 2.23
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 1.404035 GACCACATTTTATGGACGGGC 59.596 52.381 0.00 0.0 39.87 6.13
1 2 2.999331 AGACCACATTTTATGGACGGG 58.001 47.619 0.00 0.0 39.87 5.28
2 3 4.938832 TGTTAGACCACATTTTATGGACGG 59.061 41.667 0.00 0.0 39.87 4.79
25 26 8.310122 AGGGCATTATACAAATTTTCACTCAT 57.690 30.769 0.00 0.0 0.00 2.90
179 180 1.005394 CGCCTAGTGTGGACGGTTT 60.005 57.895 0.00 0.0 0.00 3.27
268 269 0.598680 CGAGTGGATCTGAATCGGGC 60.599 60.000 7.09 0.0 32.24 6.13
311 312 2.728180 CGGCGGGATCTGAATCGA 59.272 61.111 0.00 0.0 32.24 3.59
884 1226 0.933791 AGAGGTGAGGGGAGAGGGAT 60.934 60.000 0.00 0.0 0.00 3.85
955 1297 1.076777 CAACCCCGCCAGATCCATT 60.077 57.895 0.00 0.0 0.00 3.16
1150 1501 0.976641 AACTTCGAGATGCACTCCCA 59.023 50.000 9.71 0.0 42.18 4.37
1215 1566 6.187727 TGATTCAGGTAGGAAAAACAGAGT 57.812 37.500 0.00 0.0 0.00 3.24
1456 1810 5.402054 AGCACTAATCCATCCCCAATTAA 57.598 39.130 0.00 0.0 0.00 1.40
1642 1996 7.775561 GGAGGGATAAATCAACACTTGTTCTAT 59.224 37.037 0.00 0.0 35.83 1.98
2065 2421 5.009110 AGAGAAGAAAGCAAAAGTAACCAGC 59.991 40.000 0.00 0.0 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.