Multiple sequence alignment - TraesCS7A01G469500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G469500 chr7A 100.000 2321 0 0 1 2321 665977648 665979968 0.000000e+00 4287.0
1 TraesCS7A01G469500 chr7A 96.880 2340 53 4 1 2321 94445684 94443346 0.000000e+00 3899.0
2 TraesCS7A01G469500 chr2A 97.762 2324 48 2 1 2321 690342161 690344483 0.000000e+00 4000.0
3 TraesCS7A01G469500 chr3A 97.590 2324 52 2 1 2321 60827772 60825450 0.000000e+00 3978.0
4 TraesCS7A01G469500 chr3A 96.364 2338 65 5 1 2321 740090436 740088102 0.000000e+00 3829.0
5 TraesCS7A01G469500 chr5A 96.792 2338 56 4 1 2321 30143727 30146062 0.000000e+00 3884.0
6 TraesCS7A01G469500 chr2D 96.559 2296 67 4 36 2321 63681737 63684030 0.000000e+00 3792.0
7 TraesCS7A01G469500 chr7D 96.267 2277 73 4 55 2321 463977644 463979918 0.000000e+00 3723.0
8 TraesCS7A01G469500 chr5D 95.102 2348 84 9 1 2321 60521648 60519305 0.000000e+00 3670.0
9 TraesCS7A01G469500 chr6D 95.161 2335 86 6 1 2311 80673038 80670707 0.000000e+00 3661.0
10 TraesCS7A01G469500 chr1A 95.325 2289 99 4 36 2321 72584857 72587140 0.000000e+00 3627.0
11 TraesCS7A01G469500 chr2B 94.055 2355 102 10 1 2320 90758820 90761171 0.000000e+00 3539.0
12 TraesCS7A01G469500 chr2B 94.083 2349 107 9 1 2320 631382584 631380239 0.000000e+00 3539.0
13 TraesCS7A01G469500 chr1B 93.620 2351 116 11 1 2320 122762299 122764646 0.000000e+00 3480.0
14 TraesCS7A01G469500 chr3B 93.506 2356 112 11 1 2320 81550497 81548147 0.000000e+00 3465.0
15 TraesCS7A01G469500 chr3B 92.793 333 16 2 1995 2320 9254646 9254315 2.090000e-130 475.0
16 TraesCS7A01G469500 chr4B 93.390 2345 115 21 1 2320 82274870 82272541 0.000000e+00 3435.0
17 TraesCS7A01G469500 chr3D 95.553 877 21 3 1 860 448310868 448309993 0.000000e+00 1387.0
18 TraesCS7A01G469500 chr6A 86.000 100 0 1 1 86 36427330 36427231 6.830000e-16 95.3
19 TraesCS7A01G469500 chr4D 100.000 38 0 0 1 38 496006266 496006303 1.150000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G469500 chr7A 665977648 665979968 2320 False 4287 4287 100.000 1 2321 1 chr7A.!!$F1 2320
1 TraesCS7A01G469500 chr7A 94443346 94445684 2338 True 3899 3899 96.880 1 2321 1 chr7A.!!$R1 2320
2 TraesCS7A01G469500 chr2A 690342161 690344483 2322 False 4000 4000 97.762 1 2321 1 chr2A.!!$F1 2320
3 TraesCS7A01G469500 chr3A 60825450 60827772 2322 True 3978 3978 97.590 1 2321 1 chr3A.!!$R1 2320
4 TraesCS7A01G469500 chr3A 740088102 740090436 2334 True 3829 3829 96.364 1 2321 1 chr3A.!!$R2 2320
5 TraesCS7A01G469500 chr5A 30143727 30146062 2335 False 3884 3884 96.792 1 2321 1 chr5A.!!$F1 2320
6 TraesCS7A01G469500 chr2D 63681737 63684030 2293 False 3792 3792 96.559 36 2321 1 chr2D.!!$F1 2285
7 TraesCS7A01G469500 chr7D 463977644 463979918 2274 False 3723 3723 96.267 55 2321 1 chr7D.!!$F1 2266
8 TraesCS7A01G469500 chr5D 60519305 60521648 2343 True 3670 3670 95.102 1 2321 1 chr5D.!!$R1 2320
9 TraesCS7A01G469500 chr6D 80670707 80673038 2331 True 3661 3661 95.161 1 2311 1 chr6D.!!$R1 2310
10 TraesCS7A01G469500 chr1A 72584857 72587140 2283 False 3627 3627 95.325 36 2321 1 chr1A.!!$F1 2285
11 TraesCS7A01G469500 chr2B 90758820 90761171 2351 False 3539 3539 94.055 1 2320 1 chr2B.!!$F1 2319
12 TraesCS7A01G469500 chr2B 631380239 631382584 2345 True 3539 3539 94.083 1 2320 1 chr2B.!!$R1 2319
13 TraesCS7A01G469500 chr1B 122762299 122764646 2347 False 3480 3480 93.620 1 2320 1 chr1B.!!$F1 2319
14 TraesCS7A01G469500 chr3B 81548147 81550497 2350 True 3465 3465 93.506 1 2320 1 chr3B.!!$R2 2319
15 TraesCS7A01G469500 chr4B 82272541 82274870 2329 True 3435 3435 93.390 1 2320 1 chr4B.!!$R1 2319
16 TraesCS7A01G469500 chr3D 448309993 448310868 875 True 1387 1387 95.553 1 860 1 chr3D.!!$R1 859

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
838 868 1.696832 GCCTCGTCGATGTTCTTGGC 61.697 60.0 4.21 3.97 0.0 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1688 1728 0.77681 TCAACTTGGGCATTCCTCCA 59.223 50.0 0.0 0.0 36.2 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 177 6.306987 AGGATGTTTGAGCCGGATAAATATT 58.693 36.000 5.05 0.00 34.13 1.28
385 415 7.042658 CGCTACGAGCCTTATTTTAGAAGAATT 60.043 37.037 0.00 0.00 38.18 2.17
430 460 3.304829 ACTTTAAAGGCACACCACCATT 58.695 40.909 19.14 0.00 39.06 3.16
681 711 1.795786 AGGATCCTAGGCCATCTGGTA 59.204 52.381 14.27 0.00 37.57 3.25
826 856 2.574399 GGGAGACACAGCCTCGTC 59.426 66.667 0.00 0.00 0.00 4.20
838 868 1.696832 GCCTCGTCGATGTTCTTGGC 61.697 60.000 4.21 3.97 0.00 4.52
1171 1204 2.170607 ACTATCGCATACACTTGGGCTT 59.829 45.455 0.00 0.00 0.00 4.35
1424 1460 0.106769 TGCGTTGCCCCATGATATGT 60.107 50.000 0.00 0.00 0.00 2.29
1556 1593 8.154203 TGAGAGTTTCTTGTACCATATGTTGAA 58.846 33.333 1.24 0.00 0.00 2.69
1688 1728 2.308570 TGGGTAGACATGTGGAATGCTT 59.691 45.455 1.15 0.00 0.00 3.91
1689 1729 2.684881 GGGTAGACATGTGGAATGCTTG 59.315 50.000 1.15 0.00 0.00 4.01
1701 1741 0.041535 AATGCTTGGAGGAATGCCCA 59.958 50.000 0.00 0.00 37.41 5.36
2232 2281 3.697439 ATGGCGGTTCATCCACGGG 62.697 63.158 0.00 0.00 34.81 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 177 3.322541 TCGTAATAATCATCAAGGCCGGA 59.677 43.478 5.05 0.0 0.00 5.14
195 214 1.339151 CCCCTCTTTCCACTAGCACAC 60.339 57.143 0.00 0.0 0.00 3.82
385 415 7.441467 TTGAGCACAAACTGGAGAAGATCCA 62.441 44.000 0.00 0.0 43.48 3.41
430 460 2.449031 AATGGCCGTCGAGTTCAGCA 62.449 55.000 0.00 0.0 0.00 4.41
681 711 4.385825 TCTTGTAGCCACGAGAACAAAAT 58.614 39.130 0.00 0.0 41.41 1.82
826 856 0.035056 AAGAGGGGCCAAGAACATCG 60.035 55.000 4.39 0.0 0.00 3.84
838 868 1.139058 CATCCCAGTTACGAAGAGGGG 59.861 57.143 0.00 0.0 40.02 4.79
883 913 2.895404 TGACGGTACAAGAAGGCTAGTT 59.105 45.455 0.00 0.0 0.00 2.24
1171 1204 4.277672 GGCGATACTAGACACTTGGACATA 59.722 45.833 0.00 0.0 0.00 2.29
1688 1728 0.776810 TCAACTTGGGCATTCCTCCA 59.223 50.000 0.00 0.0 36.20 3.86
1689 1729 1.821136 CTTCAACTTGGGCATTCCTCC 59.179 52.381 0.00 0.0 36.20 4.30
1701 1741 4.758674 CAGGTGTGTGATCATCTTCAACTT 59.241 41.667 0.00 0.0 0.00 2.66
2082 2123 2.942604 AGAGGGCCTCTAACCTGTAA 57.057 50.000 34.34 0.0 39.28 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.