Multiple sequence alignment - TraesCS7A01G468100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G468100 chr7A 100.000 3136 0 0 1 3136 664222346 664219211 0.000000e+00 5792
1 TraesCS7A01G468100 chr2A 98.585 2544 20 4 608 3136 710248601 710251143 0.000000e+00 4484
2 TraesCS7A01G468100 chr4B 98.270 2544 29 3 606 3136 531077381 531079922 0.000000e+00 4440
3 TraesCS7A01G468100 chr4B 99.507 609 3 0 1 609 425397181 425396573 0.000000e+00 1109
4 TraesCS7A01G468100 chr5A 98.155 2547 25 7 609 3135 601209619 601207075 0.000000e+00 4423
5 TraesCS7A01G468100 chr5A 99.064 2244 16 2 896 3136 3991871 3994112 0.000000e+00 4023
6 TraesCS7A01G468100 chr5A 95.033 302 5 1 609 900 3983158 3983459 1.700000e-127 466
7 TraesCS7A01G468100 chr5A 84.153 183 23 6 608 787 180313129 180313308 4.160000e-39 172
8 TraesCS7A01G468100 chr6B 95.481 2545 93 10 608 3136 612965807 612968345 0.000000e+00 4043
9 TraesCS7A01G468100 chr6B 95.274 2264 73 7 903 3136 92572160 92574419 0.000000e+00 3557
10 TraesCS7A01G468100 chr6B 83.624 458 29 18 604 1019 706968716 706969169 3.790000e-104 388
11 TraesCS7A01G468100 chr3B 94.209 2262 71 9 908 3136 823328190 823330424 0.000000e+00 3397
12 TraesCS7A01G468100 chr3B 97.545 1711 37 3 1429 3136 82367210 82365502 0.000000e+00 2922
13 TraesCS7A01G468100 chr3B 94.235 850 33 5 614 1452 82368061 82367217 0.000000e+00 1284
14 TraesCS7A01G468100 chr3B 99.343 609 4 0 1 609 743821358 743821966 0.000000e+00 1103
15 TraesCS7A01G468100 chr3B 89.335 872 61 8 607 1450 76135570 76134703 0.000000e+00 1066
16 TraesCS7A01G468100 chr4A 97.449 1960 24 3 1200 3136 507909080 507911036 0.000000e+00 3319
17 TraesCS7A01G468100 chr4A 95.000 560 16 3 608 1156 507908524 507909082 0.000000e+00 869
18 TraesCS7A01G468100 chr6A 97.194 1960 31 3 1200 3136 338113284 338115242 0.000000e+00 3293
19 TraesCS7A01G468100 chr6A 94.662 562 16 5 606 1156 338112728 338113286 0.000000e+00 859
20 TraesCS7A01G468100 chr7B 92.766 1797 78 16 608 2357 665248954 665247163 0.000000e+00 2551
21 TraesCS7A01G468100 chr5B 82.798 436 25 18 608 996 414965571 414965139 8.330000e-91 344
22 TraesCS7A01G468100 chr5B 95.181 83 2 2 817 898 623862895 623862814 2.540000e-26 130
23 TraesCS7A01G468100 chr5B 94.048 84 3 2 817 899 627467192 627467110 3.280000e-25 126


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G468100 chr7A 664219211 664222346 3135 True 5792 5792 100.0000 1 3136 1 chr7A.!!$R1 3135
1 TraesCS7A01G468100 chr2A 710248601 710251143 2542 False 4484 4484 98.5850 608 3136 1 chr2A.!!$F1 2528
2 TraesCS7A01G468100 chr4B 531077381 531079922 2541 False 4440 4440 98.2700 606 3136 1 chr4B.!!$F1 2530
3 TraesCS7A01G468100 chr4B 425396573 425397181 608 True 1109 1109 99.5070 1 609 1 chr4B.!!$R1 608
4 TraesCS7A01G468100 chr5A 601207075 601209619 2544 True 4423 4423 98.1550 609 3135 1 chr5A.!!$R1 2526
5 TraesCS7A01G468100 chr5A 3991871 3994112 2241 False 4023 4023 99.0640 896 3136 1 chr5A.!!$F2 2240
6 TraesCS7A01G468100 chr6B 612965807 612968345 2538 False 4043 4043 95.4810 608 3136 1 chr6B.!!$F2 2528
7 TraesCS7A01G468100 chr6B 92572160 92574419 2259 False 3557 3557 95.2740 903 3136 1 chr6B.!!$F1 2233
8 TraesCS7A01G468100 chr3B 823328190 823330424 2234 False 3397 3397 94.2090 908 3136 1 chr3B.!!$F2 2228
9 TraesCS7A01G468100 chr3B 82365502 82368061 2559 True 2103 2922 95.8900 614 3136 2 chr3B.!!$R2 2522
10 TraesCS7A01G468100 chr3B 743821358 743821966 608 False 1103 1103 99.3430 1 609 1 chr3B.!!$F1 608
11 TraesCS7A01G468100 chr3B 76134703 76135570 867 True 1066 1066 89.3350 607 1450 1 chr3B.!!$R1 843
12 TraesCS7A01G468100 chr4A 507908524 507911036 2512 False 2094 3319 96.2245 608 3136 2 chr4A.!!$F1 2528
13 TraesCS7A01G468100 chr6A 338112728 338115242 2514 False 2076 3293 95.9280 606 3136 2 chr6A.!!$F1 2530
14 TraesCS7A01G468100 chr7B 665247163 665248954 1791 True 2551 2551 92.7660 608 2357 1 chr7B.!!$R1 1749

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
669 670 0.036388 CCTTGAGTGCACGGTACCAT 60.036 55.0 13.54 0.0 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2603 2768 6.959639 TTCCTCAAAAAGAAGTGCACTATT 57.04 33.333 22.01 15.35 0.0 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
657 658 0.468226 TCACAACGAAGGCCTTGAGT 59.532 50.000 26.25 19.74 0.00 3.41
669 670 0.036388 CCTTGAGTGCACGGTACCAT 60.036 55.000 13.54 0.00 0.00 3.55
672 673 1.188871 TGAGTGCACGGTACCATGGA 61.189 55.000 21.47 3.54 0.00 3.41
677 678 0.535335 GCACGGTACCATGGAAGAGA 59.465 55.000 21.47 0.00 0.00 3.10
1017 1071 2.203070 ATGGATCGTTCCCTGCGC 60.203 61.111 10.02 0.00 41.83 6.09
1487 1645 6.007703 CCTCCCTCTCTATAATCTTTCGAGT 58.992 44.000 0.00 0.00 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
166 167 3.829886 TTATGCTTTCACTTGCCGAAG 57.170 42.857 0.00 0.00 35.07 3.79
657 658 0.249120 CTCTTCCATGGTACCGTGCA 59.751 55.000 26.22 11.44 0.00 4.57
1017 1071 5.078411 TCTCCCTCATTTTCTCTTTCTCG 57.922 43.478 0.00 0.00 0.00 4.04
1487 1645 8.581578 GGAGTATAACCTGGAAACAAAATCAAA 58.418 33.333 0.00 0.00 42.06 2.69
2603 2768 6.959639 TTCCTCAAAAAGAAGTGCACTATT 57.040 33.333 22.01 15.35 0.00 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.