Multiple sequence alignment - TraesCS7A01G439000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G439000 chr7A 100.000 3231 0 0 1 3231 634136090 634132860 0 5967
1 TraesCS7A01G439000 chr7A 98.886 3232 34 2 1 3231 624753409 624756639 0 5768
2 TraesCS7A01G439000 chr7B 99.133 3231 28 0 1 3231 666520835 666524065 0 5812
3 TraesCS7A01G439000 chr7B 98.949 3234 31 3 1 3231 194133427 194130194 0 5781
4 TraesCS7A01G439000 chr6A 98.979 3231 33 0 1 3231 12687709 12690939 0 5784
5 TraesCS7A01G439000 chr6A 98.856 3233 35 2 1 3231 480643556 480640324 0 5764
6 TraesCS7A01G439000 chr6A 98.824 3232 35 3 1 3231 570896121 570892892 0 5755
7 TraesCS7A01G439000 chr1B 98.886 3231 36 0 1 3231 637620109 637616879 0 5768
8 TraesCS7A01G439000 chr6B 98.670 3233 40 2 1 3231 21358813 21362044 0 5729
9 TraesCS7A01G439000 chr4A 99.049 3049 29 0 1 3049 66552485 66555533 0 5470


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G439000 chr7A 634132860 634136090 3230 True 5967 5967 100.000 1 3231 1 chr7A.!!$R1 3230
1 TraesCS7A01G439000 chr7A 624753409 624756639 3230 False 5768 5768 98.886 1 3231 1 chr7A.!!$F1 3230
2 TraesCS7A01G439000 chr7B 666520835 666524065 3230 False 5812 5812 99.133 1 3231 1 chr7B.!!$F1 3230
3 TraesCS7A01G439000 chr7B 194130194 194133427 3233 True 5781 5781 98.949 1 3231 1 chr7B.!!$R1 3230
4 TraesCS7A01G439000 chr6A 12687709 12690939 3230 False 5784 5784 98.979 1 3231 1 chr6A.!!$F1 3230
5 TraesCS7A01G439000 chr6A 480640324 480643556 3232 True 5764 5764 98.856 1 3231 1 chr6A.!!$R1 3230
6 TraesCS7A01G439000 chr6A 570892892 570896121 3229 True 5755 5755 98.824 1 3231 1 chr6A.!!$R2 3230
7 TraesCS7A01G439000 chr1B 637616879 637620109 3230 True 5768 5768 98.886 1 3231 1 chr1B.!!$R1 3230
8 TraesCS7A01G439000 chr6B 21358813 21362044 3231 False 5729 5729 98.670 1 3231 1 chr6B.!!$F1 3230
9 TraesCS7A01G439000 chr4A 66552485 66555533 3048 False 5470 5470 99.049 1 3049 1 chr4A.!!$F1 3048

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
302 304 2.115734 AAAATGCAACCTGGCCAGCC 62.116 55.0 28.39 14.71 0.0 4.85 F
1129 1139 2.536761 TTACTACACGCAGGCAAGTT 57.463 45.0 0.00 0.00 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1404 1414 1.677576 CCCATCCGTAGTGCGTAACTA 59.322 52.381 0.0 0.0 40.56 2.24 R
2455 2467 1.997669 CTTTTCGAGCTAAGCCGTCT 58.002 50.000 0.0 0.0 0.00 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
302 304 2.115734 AAAATGCAACCTGGCCAGCC 62.116 55.000 28.39 14.71 0.00 4.85
448 451 7.847096 ACAGGAAAAACATAGGAACTTTTGTT 58.153 30.769 0.00 0.00 46.75 2.83
1129 1139 2.536761 TTACTACACGCAGGCAAGTT 57.463 45.000 0.00 0.00 0.00 2.66
1404 1414 8.579850 TTCAAATTGCTAAGGATCACTACAAT 57.420 30.769 0.00 0.00 32.12 2.71
1667 1677 3.206150 AGAAGAAGAAGAAGCGCAAACA 58.794 40.909 11.47 0.00 0.00 2.83
1873 1884 8.094548 TCTTGTATAACTGCAACTTGACTACAT 58.905 33.333 0.00 0.00 0.00 2.29
2080 2091 4.771590 ACACAATGTCCTGTATGCAAAG 57.228 40.909 0.00 0.00 0.00 2.77
2106 2118 6.708502 ACTGCAAAGTGTTTTTAAAAAGGTGT 59.291 30.769 13.58 0.00 0.00 4.16
2168 2180 2.823747 ACGTGTCCTATTACTGTGCAGA 59.176 45.455 6.17 0.00 0.00 4.26
2455 2467 7.001674 ACAGAGTTGTCAACATATTTTGGGTA 58.998 34.615 17.78 0.00 29.46 3.69
2767 2779 0.812014 TGCACCGTTGTTGTCGATGT 60.812 50.000 0.00 0.00 0.00 3.06
2777 2789 3.002102 TGTTGTCGATGTCACATCATGG 58.998 45.455 18.05 1.80 0.00 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
302 304 5.446143 AGTTGGCTAGAATAGATGTCTCG 57.554 43.478 0.00 0.0 42.77 4.04
573 576 9.866936 GTTATATGTTTTTCATCGCCGTTTATA 57.133 29.630 0.00 0.0 37.91 0.98
608 611 7.946776 TGAAAGAAGAAAGAAGAATTGGAGGAT 59.053 33.333 0.00 0.0 0.00 3.24
1020 1030 3.043465 AGCTCATTGAGATCTGGAGGA 57.957 47.619 17.87 0.0 0.00 3.71
1235 1245 2.706890 GAACATTTGCCTCGGTTCCTA 58.293 47.619 0.00 0.0 34.92 2.94
1404 1414 1.677576 CCCATCCGTAGTGCGTAACTA 59.322 52.381 0.00 0.0 40.56 2.24
1667 1677 6.183360 GCATTCAGTCTGCTTTATTGTCTCAT 60.183 38.462 0.00 0.0 36.68 2.90
1873 1884 6.134535 AGGGATATAGAAAAACACCACACA 57.865 37.500 0.00 0.0 0.00 3.72
2080 2091 7.095397 ACACCTTTTTAAAAACACTTTGCAGTC 60.095 33.333 9.31 0.0 0.00 3.51
2106 2118 3.197766 CACAGGAAATGGACACCTAGCTA 59.802 47.826 0.00 0.0 32.35 3.32
2320 2332 3.444034 CCTCCTTTGTGTCATCTCTACGA 59.556 47.826 0.00 0.0 0.00 3.43
2455 2467 1.997669 CTTTTCGAGCTAAGCCGTCT 58.002 50.000 0.00 0.0 0.00 4.18
2767 2779 3.349927 CTGAGCCTTTTCCATGATGTGA 58.650 45.455 0.00 0.0 0.00 3.58
2777 2789 3.243873 CCAACCTTTTCCTGAGCCTTTTC 60.244 47.826 0.00 0.0 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.