Multiple sequence alignment - TraesCS7A01G429800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G429800 chr7A 100.000 4308 0 0 1 4308 624762018 624757711 0 7956
1 TraesCS7A01G429800 chr6A 99.049 4309 39 2 1 4308 12696319 12692012 0 7729
2 TraesCS7A01G429800 chr6A 98.863 4309 47 2 1 4308 591838033 591842340 0 7685
3 TraesCS7A01G429800 chr6A 98.539 4311 58 4 1 4308 480634943 480639251 0 7607
4 TraesCS7A01G429800 chr6A 98.260 4311 67 7 1 4308 87938220 87942525 0 7539
5 TraesCS7A01G429800 chr6B 98.863 4310 44 5 1 4308 21367423 21363117 0 7683
6 TraesCS7A01G429800 chr1B 98.794 4311 46 6 1 4308 637611500 637615807 0 7668
7 TraesCS7A01G429800 chr7B 98.538 4310 57 6 1 4308 194124816 194129121 0 7605
8 TraesCS7A01G429800 chr2B 98.423 4311 61 6 1 4308 608462950 608458644 0 7577
9 TraesCS7A01G429800 chr2B 98.238 4313 67 8 1 4308 99562488 99566796 0 7535


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G429800 chr7A 624757711 624762018 4307 True 7956 7956 100.000 1 4308 1 chr7A.!!$R1 4307
1 TraesCS7A01G429800 chr6A 12692012 12696319 4307 True 7729 7729 99.049 1 4308 1 chr6A.!!$R1 4307
2 TraesCS7A01G429800 chr6A 591838033 591842340 4307 False 7685 7685 98.863 1 4308 1 chr6A.!!$F3 4307
3 TraesCS7A01G429800 chr6A 480634943 480639251 4308 False 7607 7607 98.539 1 4308 1 chr6A.!!$F2 4307
4 TraesCS7A01G429800 chr6A 87938220 87942525 4305 False 7539 7539 98.260 1 4308 1 chr6A.!!$F1 4307
5 TraesCS7A01G429800 chr6B 21363117 21367423 4306 True 7683 7683 98.863 1 4308 1 chr6B.!!$R1 4307
6 TraesCS7A01G429800 chr1B 637611500 637615807 4307 False 7668 7668 98.794 1 4308 1 chr1B.!!$F1 4307
7 TraesCS7A01G429800 chr7B 194124816 194129121 4305 False 7605 7605 98.538 1 4308 1 chr7B.!!$F1 4307
8 TraesCS7A01G429800 chr2B 608458644 608462950 4306 True 7577 7577 98.423 1 4308 1 chr2B.!!$R1 4307
9 TraesCS7A01G429800 chr2B 99562488 99566796 4308 False 7535 7535 98.238 1 4308 1 chr2B.!!$F1 4307

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
853 855 1.134037 TCGCACCAAAACCACCTAAGT 60.134 47.619 0.00 0.0 0.00 2.24 F
1622 1624 0.236711 CTTGGCACGAGCAGTTCTTG 59.763 55.000 7.26 0.0 44.61 3.02 F
2443 2449 0.039798 CAGCATGTCCAGTTGCACAC 60.040 55.000 0.00 0.0 41.35 3.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2065 2071 1.175983 TGACAACCATTGAACCGGCC 61.176 55.000 0.00 0.00 0.00 6.13 R
2675 2683 1.621317 TCAATGTTGTCCAGCGTCCTA 59.379 47.619 0.00 0.00 0.00 2.94 R
3514 3525 8.409371 TGAATTAGTTCATGCACTGTGTAAAAA 58.591 29.630 8.37 1.29 39.36 1.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
469 470 2.590821 ACTTTGCCATTGACAAGAGCT 58.409 42.857 12.06 0.00 0.00 4.09
650 652 2.433239 ACGTGGTCCAGAAGTGTAAAGT 59.567 45.455 0.00 0.00 0.00 2.66
853 855 1.134037 TCGCACCAAAACCACCTAAGT 60.134 47.619 0.00 0.00 0.00 2.24
1094 1096 1.302832 GTCAGGAAGGCACCACTGG 60.303 63.158 0.00 0.00 0.00 4.00
1622 1624 0.236711 CTTGGCACGAGCAGTTCTTG 59.763 55.000 7.26 0.00 44.61 3.02
1695 1697 4.222810 TCTCAAAGGTCTCCATTCATCGAA 59.777 41.667 0.00 0.00 0.00 3.71
2065 2071 8.703604 TTAAAGGAGTTAGTTGATTCGATGAG 57.296 34.615 0.00 0.00 0.00 2.90
2103 2109 9.959749 GGTTGTCAAAAATTGTTATTGAGACTA 57.040 29.630 0.00 0.00 34.02 2.59
2443 2449 0.039798 CAGCATGTCCAGTTGCACAC 60.040 55.000 0.00 0.00 41.35 3.82
2675 2683 4.084328 CGCTTCGAAGTTCTTGATTCAAGT 60.084 41.667 25.24 6.63 41.66 3.16
2792 2800 6.238953 GCATTGAGCACTTCCAGATTATTGAT 60.239 38.462 0.00 0.00 44.79 2.57
2832 2840 5.412594 CAGCTTGGCAAGTAAGACAATAAGA 59.587 40.000 26.71 0.00 35.62 2.10
3514 3525 5.427378 ACAAAGGCACAAATAGCAACTTTT 58.573 33.333 0.00 0.00 0.00 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
469 470 7.566760 TTTCAGCTTCAGTTGATAAGAACAA 57.433 32.000 0.00 0.00 35.26 2.83
650 652 7.663081 ACTGCAGATTCTTCTTCATTGAAACTA 59.337 33.333 23.35 0.00 0.00 2.24
1094 1096 0.954452 CACCTTGGGACTTGCAGTTC 59.046 55.000 0.00 0.00 0.00 3.01
1225 1227 5.755849 AGGCTTGCACCTACTTATAATGTT 58.244 37.500 0.00 0.00 38.67 2.71
1435 1437 1.409427 GGCTTCCGCTGTATCTACTGT 59.591 52.381 0.00 0.00 36.09 3.55
1695 1697 6.318648 TGCTGAAAGTCTTGTTCTTGTTGTAT 59.681 34.615 0.00 0.00 35.30 2.29
2017 2023 9.515226 TTAAAGAAATGTAGAAAGCACCATACT 57.485 29.630 0.00 0.00 0.00 2.12
2065 2071 1.175983 TGACAACCATTGAACCGGCC 61.176 55.000 0.00 0.00 0.00 6.13
2103 2109 6.363065 AGTTATCCATGATGTGCAAGATTCT 58.637 36.000 0.00 0.00 0.00 2.40
2443 2449 2.412870 TGCCAACTAACAGATGTGTCG 58.587 47.619 0.00 0.00 35.08 4.35
2675 2683 1.621317 TCAATGTTGTCCAGCGTCCTA 59.379 47.619 0.00 0.00 0.00 2.94
3514 3525 8.409371 TGAATTAGTTCATGCACTGTGTAAAAA 58.591 29.630 8.37 1.29 39.36 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.