Multiple sequence alignment - TraesCS7A01G429700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G429700 chr7A 100.000 2663 0 0 1 2663 624756691 624759353 0 4918
1 TraesCS7A01G429700 chr7A 98.388 2668 34 7 1 2663 634132808 634130145 0 4680
2 TraesCS7A01G429700 chr6A 99.024 2664 24 2 1 2663 12690991 12693653 0 4774
3 TraesCS7A01G429700 chr6A 98.986 2664 26 1 1 2663 591843361 591840698 0 4769
4 TraesCS7A01G429700 chr6A 98.386 2665 38 5 1 2663 87943546 87940885 0 4678
5 TraesCS7A01G429700 chr6B 98.799 2665 28 4 1 2663 21362096 21364758 0 4741
6 TraesCS7A01G429700 chr1B 98.648 2663 33 3 1 2663 637616827 637614168 0 4715
7 TraesCS7A01G429700 chr2B 98.574 2664 36 2 1 2663 608457623 608460285 0 4708
8 TraesCS7A01G429700 chr7B 98.462 2665 38 3 1 2663 194130142 194127479 0 4691
9 TraesCS7A01G429700 chr2A 98.425 2667 37 5 1 2663 389206953 389209618 0 4687


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G429700 chr7A 624756691 624759353 2662 False 4918 4918 100.000 1 2663 1 chr7A.!!$F1 2662
1 TraesCS7A01G429700 chr7A 634130145 634132808 2663 True 4680 4680 98.388 1 2663 1 chr7A.!!$R1 2662
2 TraesCS7A01G429700 chr6A 12690991 12693653 2662 False 4774 4774 99.024 1 2663 1 chr6A.!!$F1 2662
3 TraesCS7A01G429700 chr6A 591840698 591843361 2663 True 4769 4769 98.986 1 2663 1 chr6A.!!$R2 2662
4 TraesCS7A01G429700 chr6A 87940885 87943546 2661 True 4678 4678 98.386 1 2663 1 chr6A.!!$R1 2662
5 TraesCS7A01G429700 chr6B 21362096 21364758 2662 False 4741 4741 98.799 1 2663 1 chr6B.!!$F1 2662
6 TraesCS7A01G429700 chr1B 637614168 637616827 2659 True 4715 4715 98.648 1 2663 1 chr1B.!!$R1 2662
7 TraesCS7A01G429700 chr2B 608457623 608460285 2662 False 4708 4708 98.574 1 2663 1 chr2B.!!$F1 2662
8 TraesCS7A01G429700 chr7B 194127479 194130142 2663 True 4691 4691 98.462 1 2663 1 chr7B.!!$R1 2662
9 TraesCS7A01G429700 chr2A 389206953 389209618 2665 False 4687 4687 98.425 1 2663 1 chr2A.!!$F1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
646 648 1.134401 ACATACTGCCTAGTTGCGCAT 60.134 47.619 12.75 0.0 38.36 4.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2556 2569 3.834231 AGCATTACCCAAAGTTCAGCATT 59.166 39.13 0.0 0.0 0.0 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
646 648 1.134401 ACATACTGCCTAGTTGCGCAT 60.134 47.619 12.75 0.0 38.36 4.73
676 678 4.584029 AGTTCACGCATCAAAGATAACG 57.416 40.909 0.00 0.0 0.00 3.18
756 758 1.982395 CCCTCCTGGCTGTACACGA 60.982 63.158 0.00 0.0 0.00 4.35
875 877 4.847512 TCCCCATCAAACTAGGTCTGTAAA 59.152 41.667 0.00 0.0 0.00 2.01
2556 2569 8.212995 TCAATATCAATAATCTGGAAGTGCTCA 58.787 33.333 0.00 0.0 33.76 4.26
2652 2665 1.621317 TCAATGTTGTCCAGCGTCCTA 59.379 47.619 0.00 0.0 0.00 2.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
646 648 1.798223 GATGCGTGAACTAACACAGCA 59.202 47.619 15.50 15.5 45.48 4.41
756 758 3.083997 GGAGGTGGCGGAGGATGT 61.084 66.667 0.00 0.0 0.00 3.06
779 781 1.076559 CCATTGGGAGGAGCATGCA 60.077 57.895 21.98 0.0 35.59 3.96
875 877 3.101437 ACCATGATGTGTGCAATTGGAT 58.899 40.909 7.72 0.0 0.00 3.41
2495 2508 5.412594 CAGCTTGGCAAGTAAGACAATAAGA 59.587 40.000 26.71 0.0 35.62 2.10
2535 2548 6.238953 GCATTGAGCACTTCCAGATTATTGAT 60.239 38.462 0.00 0.0 44.79 2.57
2556 2569 3.834231 AGCATTACCCAAAGTTCAGCATT 59.166 39.130 0.00 0.0 0.00 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.