Multiple sequence alignment - TraesCS7A01G426500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G426500 chr7A 100.000 2654 0 0 1 2654 619562259 619564912 0.000000e+00 4902
1 TraesCS7A01G426500 chr7A 95.502 1334 60 0 1086 2419 169733849 169732516 0.000000e+00 2132
2 TraesCS7A01G426500 chr7A 89.445 739 49 15 1084 1813 222638417 222637699 0.000000e+00 905
3 TraesCS7A01G426500 chr7A 94.301 386 17 3 701 1085 169734264 169733883 1.060000e-163 586
4 TraesCS7A01G426500 chr7A 99.194 248 2 0 2407 2654 169687250 169687003 5.210000e-122 448
5 TraesCS7A01G426500 chr5A 96.492 1397 20 4 1264 2654 396378951 396380324 0.000000e+00 2281
6 TraesCS7A01G426500 chr5A 95.172 787 23 8 1 774 119076608 119077392 0.000000e+00 1229
7 TraesCS7A01G426500 chr5A 97.724 703 14 2 1 703 44928607 44929307 0.000000e+00 1208
8 TraesCS7A01G426500 chr5A 97.922 385 6 2 701 1085 396369623 396370005 0.000000e+00 665
9 TraesCS7A01G426500 chr5A 97.297 185 5 0 1086 1270 396370039 396370223 5.510000e-82 315
10 TraesCS7A01G426500 chr5A 87.349 166 19 1 660 823 595922808 595922643 3.490000e-44 189
11 TraesCS7A01G426500 chr2B 96.199 1105 41 1 1548 2652 464825692 464824589 0.000000e+00 1807
12 TraesCS7A01G426500 chr6B 94.980 1016 47 2 1086 2097 438944963 438945978 0.000000e+00 1591
13 TraesCS7A01G426500 chr6B 93.630 832 49 4 1823 2652 471513365 471512536 0.000000e+00 1240
14 TraesCS7A01G426500 chr6B 96.435 561 19 1 2092 2652 438952413 438952972 0.000000e+00 924
15 TraesCS7A01G426500 chr6B 94.090 423 21 4 664 1085 438944508 438944927 8.010000e-180 640
16 TraesCS7A01G426500 chr6B 84.366 339 40 8 701 1034 471534708 471534378 1.190000e-83 320
17 TraesCS7A01G426500 chr6A 97.105 760 13 5 1 755 270783471 270784226 0.000000e+00 1273
18 TraesCS7A01G426500 chr7D 94.515 784 29 10 1 775 264959936 264960714 0.000000e+00 1197
19 TraesCS7A01G426500 chr7D 97.013 703 18 3 1 702 149983 150683 0.000000e+00 1179
20 TraesCS7A01G426500 chr7D 96.601 706 18 6 6 708 264964581 264965283 0.000000e+00 1166
21 TraesCS7A01G426500 chr7D 89.160 738 40 17 1084 1814 210022182 210021478 0.000000e+00 883
22 TraesCS7A01G426500 chr2D 95.693 743 27 5 1 741 628812937 628812198 0.000000e+00 1190
23 TraesCS7A01G426500 chrUn 96.434 701 20 3 1 701 259646003 259645308 0.000000e+00 1151
24 TraesCS7A01G426500 chrUn 85.876 177 21 4 649 822 250550472 250550297 4.510000e-43 185
25 TraesCS7A01G426500 chrUn 85.876 177 21 4 649 822 261964557 261964382 4.510000e-43 185
26 TraesCS7A01G426500 chrUn 85.876 177 21 4 649 822 273752501 273752676 4.510000e-43 185
27 TraesCS7A01G426500 chr4A 95.720 701 24 5 1 701 52647249 52646555 0.000000e+00 1123
28 TraesCS7A01G426500 chr4A 92.297 701 52 2 1954 2652 377618141 377617441 0.000000e+00 994
29 TraesCS7A01G426500 chr7B 92.263 685 42 3 1084 1765 191521954 191522630 0.000000e+00 961
30 TraesCS7A01G426500 chr7B 93.103 145 9 1 712 856 7347391 7347534 7.440000e-51 211
31 TraesCS7A01G426500 chr1A 81.497 481 77 8 1862 2333 436218969 436219446 4.140000e-103 385
32 TraesCS7A01G426500 chr3B 88.824 170 16 3 655 822 697163595 697163427 3.460000e-49 206
33 TraesCS7A01G426500 chr2A 88.750 160 17 1 664 823 444003496 444003338 7.500000e-46 195


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G426500 chr7A 619562259 619564912 2653 False 4902.0 4902 100.0000 1 2654 1 chr7A.!!$F1 2653
1 TraesCS7A01G426500 chr7A 169732516 169734264 1748 True 1359.0 2132 94.9015 701 2419 2 chr7A.!!$R3 1718
2 TraesCS7A01G426500 chr7A 222637699 222638417 718 True 905.0 905 89.4450 1084 1813 1 chr7A.!!$R2 729
3 TraesCS7A01G426500 chr5A 396378951 396380324 1373 False 2281.0 2281 96.4920 1264 2654 1 chr5A.!!$F3 1390
4 TraesCS7A01G426500 chr5A 119076608 119077392 784 False 1229.0 1229 95.1720 1 774 1 chr5A.!!$F2 773
5 TraesCS7A01G426500 chr5A 44928607 44929307 700 False 1208.0 1208 97.7240 1 703 1 chr5A.!!$F1 702
6 TraesCS7A01G426500 chr5A 396369623 396370223 600 False 490.0 665 97.6095 701 1270 2 chr5A.!!$F4 569
7 TraesCS7A01G426500 chr2B 464824589 464825692 1103 True 1807.0 1807 96.1990 1548 2652 1 chr2B.!!$R1 1104
8 TraesCS7A01G426500 chr6B 471512536 471513365 829 True 1240.0 1240 93.6300 1823 2652 1 chr6B.!!$R1 829
9 TraesCS7A01G426500 chr6B 438944508 438945978 1470 False 1115.5 1591 94.5350 664 2097 2 chr6B.!!$F2 1433
10 TraesCS7A01G426500 chr6B 438952413 438952972 559 False 924.0 924 96.4350 2092 2652 1 chr6B.!!$F1 560
11 TraesCS7A01G426500 chr6A 270783471 270784226 755 False 1273.0 1273 97.1050 1 755 1 chr6A.!!$F1 754
12 TraesCS7A01G426500 chr7D 264959936 264965283 5347 False 1181.5 1197 95.5580 1 775 2 chr7D.!!$F2 774
13 TraesCS7A01G426500 chr7D 149983 150683 700 False 1179.0 1179 97.0130 1 702 1 chr7D.!!$F1 701
14 TraesCS7A01G426500 chr7D 210021478 210022182 704 True 883.0 883 89.1600 1084 1814 1 chr7D.!!$R1 730
15 TraesCS7A01G426500 chr2D 628812198 628812937 739 True 1190.0 1190 95.6930 1 741 1 chr2D.!!$R1 740
16 TraesCS7A01G426500 chrUn 259645308 259646003 695 True 1151.0 1151 96.4340 1 701 1 chrUn.!!$R2 700
17 TraesCS7A01G426500 chr4A 52646555 52647249 694 True 1123.0 1123 95.7200 1 701 1 chr4A.!!$R1 700
18 TraesCS7A01G426500 chr4A 377617441 377618141 700 True 994.0 994 92.2970 1954 2652 1 chr4A.!!$R2 698
19 TraesCS7A01G426500 chr7B 191521954 191522630 676 False 961.0 961 92.2630 1084 1765 1 chr7B.!!$F2 681

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
298 300 2.719157 AGCCTTTTCTTTCCCCTCTCTT 59.281 45.455 0.00 0.0 0.0 2.85 F
1183 1235 3.185299 TTCCCGTGCGACACCCAAT 62.185 57.895 4.73 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1475 3854 1.030457 AAGTCAGAACACCGACGAGT 58.970 50.000 0.00 0.0 37.23 4.18 R
2026 4842 4.068599 TCTCGACGAGCTCTATCATCATT 58.931 43.478 20.11 0.0 0.00 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 300 2.719157 AGCCTTTTCTTTCCCCTCTCTT 59.281 45.455 0.00 0.00 0.00 2.85
357 359 3.228453 CAAAGGAATATGATGGCTGCCT 58.772 45.455 21.03 5.22 0.00 4.75
578 580 4.746729 TCAACATGGCATAGAAAATGCAC 58.253 39.130 11.69 2.71 46.21 4.57
712 727 9.057089 GGCATTTGTGCTAGTAATAATAAGAGT 57.943 33.333 0.07 0.00 34.73 3.24
1182 1234 3.862991 TTCCCGTGCGACACCCAA 61.863 61.111 4.73 0.00 0.00 4.12
1183 1235 3.185299 TTCCCGTGCGACACCCAAT 62.185 57.895 4.73 0.00 0.00 3.16
1475 3854 2.436539 CGTCGTCGTCGTCGGACTA 61.437 63.158 12.82 0.00 42.57 2.59
1512 3891 2.498481 ACTTGTATAGCTTACGTGGCCA 59.502 45.455 0.00 0.00 0.00 5.36
1751 4562 0.107214 TGATGAATTCACGAGGGGGC 60.107 55.000 11.07 0.00 0.00 5.80
1802 4616 3.329386 TGCTACTGCTTCATCTTGTGTC 58.671 45.455 0.00 0.00 40.48 3.67
2026 4842 5.560722 TGAATCTGTCCTTGACAAACCTA 57.439 39.130 0.00 0.00 42.26 3.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 4.036027 CCATGATCCACAACTTATGTCTGC 59.964 45.833 0.00 0.00 41.46 4.26
271 273 3.336694 AGGGGAAAGAAAAGGCTTCCATA 59.663 43.478 0.00 0.00 0.00 2.74
298 300 7.093727 GGCAAGGATAAGAGCAGTAGTATGATA 60.094 40.741 0.00 0.00 0.00 2.15
357 359 3.118000 TCGCTGAGGAGGACTATCACTAA 60.118 47.826 0.00 0.00 0.00 2.24
531 533 8.599624 AAGGACCAATCTCATAATTCACAAAT 57.400 30.769 0.00 0.00 0.00 2.32
828 845 6.969043 TCAAATTGGTTGTATAGGACATCCT 58.031 36.000 5.59 5.59 45.06 3.24
1133 1185 2.970324 GCAGCACGTTCCGGAACA 60.970 61.111 38.72 10.18 41.20 3.18
1378 1430 2.657237 CCTCACGTCGAAGCCCTT 59.343 61.111 0.00 0.00 0.00 3.95
1475 3854 1.030457 AAGTCAGAACACCGACGAGT 58.970 50.000 0.00 0.00 37.23 4.18
1512 3891 1.210478 GACTACCACATCCACATGGCT 59.790 52.381 0.00 0.00 39.84 4.75
1751 4562 3.120408 CGGTTTGCATCAGAAGTTCAGAG 60.120 47.826 5.50 0.00 0.00 3.35
1802 4616 8.604640 ACTATGCATCAGAAGATTCAGTAATG 57.395 34.615 0.19 0.00 31.04 1.90
1986 4802 6.531594 CAGATTCAATACTAACTCAAGTGCGA 59.468 38.462 0.00 0.00 0.00 5.10
2026 4842 4.068599 TCTCGACGAGCTCTATCATCATT 58.931 43.478 20.11 0.00 0.00 2.57
2336 5294 4.234574 GCATGTATCGACGATAATGTGGA 58.765 43.478 18.69 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.