Multiple sequence alignment - TraesCS7A01G423000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G423000 chr7A 100.000 2285 0 0 1 2285 613755276 613752992 0.000000e+00 4220
1 TraesCS7A01G423000 chr3A 98.468 2285 35 0 1 2285 627956949 627954665 0.000000e+00 4026
2 TraesCS7A01G423000 chr3A 98.337 2285 36 2 1 2285 514528941 514531223 0.000000e+00 4008
3 TraesCS7A01G423000 chr3A 97.482 278 7 0 31 308 653871078 653871355 2.050000e-130 475
4 TraesCS7A01G423000 chr6B 98.293 2285 38 1 1 2285 439442973 439440690 0.000000e+00 4002
5 TraesCS7A01G423000 chr6A 98.206 2285 41 0 1 2285 214163117 214160833 0.000000e+00 3993
6 TraesCS7A01G423000 chr7B 97.725 2286 49 2 1 2285 577195719 577193436 0.000000e+00 3930
7 TraesCS7A01G423000 chr1A 97.635 2283 54 0 3 2285 64891384 64889102 0.000000e+00 3917
8 TraesCS7A01G423000 chr5B 97.970 2118 31 2 115 2232 255655796 255657901 0.000000e+00 3663
9 TraesCS7A01G423000 chr5B 98.256 1949 34 0 337 2285 524582648 524580700 0.000000e+00 3411
10 TraesCS7A01G423000 chr1B 95.253 2233 82 8 1 2232 631842863 631845072 0.000000e+00 3515


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G423000 chr7A 613752992 613755276 2284 True 4220 4220 100.000 1 2285 1 chr7A.!!$R1 2284
1 TraesCS7A01G423000 chr3A 627954665 627956949 2284 True 4026 4026 98.468 1 2285 1 chr3A.!!$R1 2284
2 TraesCS7A01G423000 chr3A 514528941 514531223 2282 False 4008 4008 98.337 1 2285 1 chr3A.!!$F1 2284
3 TraesCS7A01G423000 chr6B 439440690 439442973 2283 True 4002 4002 98.293 1 2285 1 chr6B.!!$R1 2284
4 TraesCS7A01G423000 chr6A 214160833 214163117 2284 True 3993 3993 98.206 1 2285 1 chr6A.!!$R1 2284
5 TraesCS7A01G423000 chr7B 577193436 577195719 2283 True 3930 3930 97.725 1 2285 1 chr7B.!!$R1 2284
6 TraesCS7A01G423000 chr1A 64889102 64891384 2282 True 3917 3917 97.635 3 2285 1 chr1A.!!$R1 2282
7 TraesCS7A01G423000 chr5B 255655796 255657901 2105 False 3663 3663 97.970 115 2232 1 chr5B.!!$F1 2117
8 TraesCS7A01G423000 chr5B 524580700 524582648 1948 True 3411 3411 98.256 337 2285 1 chr5B.!!$R1 1948
9 TraesCS7A01G423000 chr1B 631842863 631845072 2209 False 3515 3515 95.253 1 2232 1 chr1B.!!$F1 2231

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
52 54 0.036952 ACATCAGTTAGTGCAGCGCT 60.037 50.0 14.22 14.22 0.0 5.92 F
366 368 1.021390 ACTACACAATGCAGCGCCTC 61.021 55.0 2.29 0.00 0.0 4.70 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1218 1221 1.214367 CGTTAGTTGGAAGTGCACGT 58.786 50.0 12.01 8.44 0.0 4.49 R
1830 1833 5.047872 ACTGCAGCATCACAACAATATGAAA 60.048 36.0 15.27 0.00 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
52 54 0.036952 ACATCAGTTAGTGCAGCGCT 60.037 50.000 14.22 14.22 0.00 5.92
113 115 2.866726 TAGGCGCTGCACACTGACA 61.867 57.895 7.64 0.00 0.00 3.58
355 357 2.281208 GGGCGCCACACTACACAA 60.281 61.111 30.85 0.00 0.00 3.33
366 368 1.021390 ACTACACAATGCAGCGCCTC 61.021 55.000 2.29 0.00 0.00 4.70
368 370 2.779951 TACACAATGCAGCGCCTCGT 62.780 55.000 2.29 0.00 0.00 4.18
382 384 3.068691 TCGTCCTTAGGCGCTGCT 61.069 61.111 7.64 0.00 0.00 4.24
553 555 2.674754 CCTTTCCCTTGGGCGCTA 59.325 61.111 7.64 0.00 0.00 4.26
1030 1033 1.224592 GGTTCCATGACGAGGCCAT 59.775 57.895 5.01 0.00 0.00 4.40
1110 1113 5.474876 GGTGAAGGAGAAAGATGTCAACATT 59.525 40.000 0.00 0.00 36.57 2.71
1218 1221 3.552132 TGCCCGAACTATGCTTATGAA 57.448 42.857 0.00 0.00 0.00 2.57
1731 1734 4.162509 GGTGAACTATCTTCTAGGGCAAGT 59.837 45.833 0.00 0.00 0.00 3.16
1830 1833 5.282510 TCGTCGGCATAAAATTTGTGTTTT 58.717 33.333 4.48 0.00 35.60 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 115 5.600696 CTTTTCCACCACAAAAACTGCTAT 58.399 37.500 0.00 0.00 0.00 2.97
179 181 2.046892 ACCTTAGGCGCTGCACAG 60.047 61.111 7.64 0.00 0.00 3.66
355 357 2.635229 CTAAGGACGAGGCGCTGCAT 62.635 60.000 7.64 0.00 0.00 3.96
366 368 2.583593 GAGCAGCGCCTAAGGACG 60.584 66.667 2.29 0.00 0.00 4.79
368 370 1.544825 AACAGAGCAGCGCCTAAGGA 61.545 55.000 2.29 0.00 0.00 3.36
382 384 1.254975 TAGGCGCTGCACCTAACAGA 61.255 55.000 13.76 0.00 36.83 3.41
523 525 0.676782 GGAAAGGCGCCACACTACAT 60.677 55.000 31.54 0.76 0.00 2.29
553 555 5.824624 CAGCCTAATAAATGTCCAGATGTGT 59.175 40.000 0.00 0.00 0.00 3.72
1030 1033 2.101750 TGTCTTCTTGGTTAGCACACGA 59.898 45.455 0.00 0.00 0.00 4.35
1110 1113 1.794151 CTGCACACCAACATTGCGGA 61.794 55.000 0.00 0.00 44.07 5.54
1218 1221 1.214367 CGTTAGTTGGAAGTGCACGT 58.786 50.000 12.01 8.44 0.00 4.49
1731 1734 7.660617 ACATTCATTACAAATGACAAATGGCAA 59.339 29.630 13.37 0.00 36.16 4.52
1830 1833 5.047872 ACTGCAGCATCACAACAATATGAAA 60.048 36.000 15.27 0.00 0.00 2.69
2108 2111 9.250624 CTTAGCATGTCCAGTTTATAGTACTTC 57.749 37.037 0.00 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.