Multiple sequence alignment - TraesCS7A01G419000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G419000 chr7A 100.000 2561 0 0 1 2561 610463552 610460992 0.000000e+00 4730
1 TraesCS7A01G419000 chr7A 75.684 1316 290 22 990 2298 126148074 126149366 4.650000e-177 630
2 TraesCS7A01G419000 chr4A 98.287 2568 37 2 1 2561 180271620 180269053 0.000000e+00 4492
3 TraesCS7A01G419000 chr4A 94.504 1692 89 2 870 2561 729544596 729542909 0.000000e+00 2606
4 TraesCS7A01G419000 chr4A 95.007 721 34 2 1 720 729545311 729544592 0.000000e+00 1131
5 TraesCS7A01G419000 chr6A 98.132 2570 34 11 1 2561 15386870 15384306 0.000000e+00 4468
6 TraesCS7A01G419000 chr6A 75.321 1325 277 35 990 2298 137493927 137492637 7.890000e-165 590
7 TraesCS7A01G419000 chr3B 96.206 1476 49 4 1088 2561 607809354 607807884 0.000000e+00 2409
8 TraesCS7A01G419000 chr3B 96.344 1094 35 4 1 1089 607810541 607809448 0.000000e+00 1794
9 TraesCS7A01G419000 chr3B 76.194 1319 278 26 990 2298 473235215 473236507 0.000000e+00 664
10 TraesCS7A01G419000 chr3B 87.193 367 35 7 1 359 534161150 534161512 8.530000e-110 407
11 TraesCS7A01G419000 chr7D 97.902 1287 26 1 1275 2561 194638625 194639910 0.000000e+00 2226
12 TraesCS7A01G419000 chr7D 96.960 1217 35 2 1 1216 194637413 194638628 0.000000e+00 2041
13 TraesCS7A01G419000 chr3A 98.762 646 7 1 1 645 584382218 584382863 0.000000e+00 1147
14 TraesCS7A01G419000 chr5A 98.887 629 7 0 1 629 567267140 567267768 0.000000e+00 1123
15 TraesCS7A01G419000 chr4B 75.114 1318 292 25 990 2298 321541563 321542853 3.670000e-163 584


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G419000 chr7A 610460992 610463552 2560 True 4730.0 4730 100.0000 1 2561 1 chr7A.!!$R1 2560
1 TraesCS7A01G419000 chr7A 126148074 126149366 1292 False 630.0 630 75.6840 990 2298 1 chr7A.!!$F1 1308
2 TraesCS7A01G419000 chr4A 180269053 180271620 2567 True 4492.0 4492 98.2870 1 2561 1 chr4A.!!$R1 2560
3 TraesCS7A01G419000 chr4A 729542909 729545311 2402 True 1868.5 2606 94.7555 1 2561 2 chr4A.!!$R2 2560
4 TraesCS7A01G419000 chr6A 15384306 15386870 2564 True 4468.0 4468 98.1320 1 2561 1 chr6A.!!$R1 2560
5 TraesCS7A01G419000 chr6A 137492637 137493927 1290 True 590.0 590 75.3210 990 2298 1 chr6A.!!$R2 1308
6 TraesCS7A01G419000 chr3B 607807884 607810541 2657 True 2101.5 2409 96.2750 1 2561 2 chr3B.!!$R1 2560
7 TraesCS7A01G419000 chr3B 473235215 473236507 1292 False 664.0 664 76.1940 990 2298 1 chr3B.!!$F1 1308
8 TraesCS7A01G419000 chr7D 194637413 194639910 2497 False 2133.5 2226 97.4310 1 2561 2 chr7D.!!$F1 2560
9 TraesCS7A01G419000 chr3A 584382218 584382863 645 False 1147.0 1147 98.7620 1 645 1 chr3A.!!$F1 644
10 TraesCS7A01G419000 chr5A 567267140 567267768 628 False 1123.0 1123 98.8870 1 629 1 chr5A.!!$F1 628
11 TraesCS7A01G419000 chr4B 321541563 321542853 1290 False 584.0 584 75.1140 990 2298 1 chr4B.!!$F1 1308

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
431 432 5.602561 ACCTAGATTTTCTTGTGCCCTTTTT 59.397 36.0 0.0 0.0 0.0 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1614 1725 2.837532 AATGCGCCCAAACAATTCTT 57.162 40.0 4.18 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 379 7.758076 GCTCACATTGTATTGTACTGTACTACA 59.242 37.037 17.98 15.26 0.00 2.74
431 432 5.602561 ACCTAGATTTTCTTGTGCCCTTTTT 59.397 36.000 0.00 0.00 0.00 1.94
647 649 8.779354 TGTTTTAGTTTGTTAGGTTGCAAAAT 57.221 26.923 0.00 0.00 36.51 1.82
1979 2090 8.642432 AGCGCAGAGGAATATTATAATATGCTA 58.358 33.333 18.96 0.00 32.17 3.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 379 6.259608 GCAGTAAGCATCAGATTTACAGTGAT 59.740 38.462 0.00 0.00 44.79 3.06
431 432 6.880484 TCTTATAGTATCACCCTCGCAAAAA 58.120 36.000 0.00 0.00 0.00 1.94
647 649 5.009610 GGAAAGACAGCTCCAAACATGTTTA 59.990 40.000 22.87 8.46 0.00 2.01
1614 1725 2.837532 AATGCGCCCAAACAATTCTT 57.162 40.000 4.18 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.