Multiple sequence alignment - TraesCS7A01G410600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G410600 chr7A 100.000 2789 0 0 1 2789 597567525 597564737 0.000000e+00 5151.0
1 TraesCS7A01G410600 chr7A 97.421 2637 60 3 1 2635 597644914 597642284 0.000000e+00 4486.0
2 TraesCS7A01G410600 chr7A 97.500 160 1 2 2630 2789 597642240 597642084 1.270000e-68 270.0
3 TraesCS7A01G410600 chr7A 85.401 137 16 2 1124 1256 598215857 598215993 3.750000e-29 139.0
4 TraesCS7A01G410600 chr7A 86.087 115 10 3 817 931 598214969 598214861 4.880000e-23 119.0
5 TraesCS7A01G410600 chr7D 88.109 841 65 12 1049 1873 520826848 520826027 0.000000e+00 966.0
6 TraesCS7A01G410600 chr7D 93.186 543 35 2 1 543 109625942 109625402 0.000000e+00 797.0
7 TraesCS7A01G410600 chr5B 91.824 636 29 8 2013 2630 410217146 410217776 0.000000e+00 865.0
8 TraesCS7A01G410600 chr5B 92.593 162 10 2 2630 2789 410217884 410218045 6.010000e-57 231.0
9 TraesCS7A01G410600 chr5B 95.745 47 2 0 1955 2001 410217115 410217161 2.980000e-10 76.8
10 TraesCS7A01G410600 chr5B 89.583 48 4 1 1955 2002 311599537 311599583 3.000000e-05 60.2
11 TraesCS7A01G410600 chr2B 91.509 636 33 5 2013 2630 160473763 160474395 0.000000e+00 856.0
12 TraesCS7A01G410600 chr2B 94.444 162 7 1 2630 2789 160474503 160474664 5.970000e-62 248.0
13 TraesCS7A01G410600 chr2B 91.525 59 3 2 1944 2001 160473721 160473778 2.300000e-11 80.5
14 TraesCS7A01G410600 chr3A 93.554 543 32 3 1 543 704961163 704961702 0.000000e+00 806.0
15 TraesCS7A01G410600 chrUn 93.015 544 36 2 1 544 356095766 356096307 0.000000e+00 793.0
16 TraesCS7A01G410600 chrUn 93.015 544 36 2 1 544 356141228 356141769 0.000000e+00 793.0
17 TraesCS7A01G410600 chrUn 97.368 38 0 1 1955 1991 339294876 339294913 2.320000e-06 63.9
18 TraesCS7A01G410600 chr1A 93.015 544 36 2 1 544 291558647 291559188 0.000000e+00 793.0
19 TraesCS7A01G410600 chr3D 93.002 543 36 2 1 543 604121235 604121775 0.000000e+00 791.0
20 TraesCS7A01G410600 chr3D 89.796 49 4 1 1938 1985 129220918 129220966 8.340000e-06 62.1
21 TraesCS7A01G410600 chr6D 92.831 544 37 2 1 544 393923938 393924479 0.000000e+00 787.0
22 TraesCS7A01G410600 chr6B 92.818 543 37 2 1 543 130977441 130976901 0.000000e+00 785.0
23 TraesCS7A01G410600 chr6B 90.909 55 4 1 1938 1991 218025358 218025412 3.850000e-09 73.1
24 TraesCS7A01G410600 chr7B 84.536 97 11 4 2336 2429 55401365 55401270 2.960000e-15 93.5
25 TraesCS7A01G410600 chr1D 89.583 48 4 1 1955 2002 258011601 258011647 3.000000e-05 60.2
26 TraesCS7A01G410600 chr2A 86.275 51 7 0 1933 1983 18186060 18186110 3.880000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G410600 chr7A 597564737 597567525 2788 True 5151.000000 5151 100.000000 1 2789 1 chr7A.!!$R1 2788
1 TraesCS7A01G410600 chr7A 597642084 597644914 2830 True 2378.000000 4486 97.460500 1 2789 2 chr7A.!!$R3 2788
2 TraesCS7A01G410600 chr7D 520826027 520826848 821 True 966.000000 966 88.109000 1049 1873 1 chr7D.!!$R2 824
3 TraesCS7A01G410600 chr7D 109625402 109625942 540 True 797.000000 797 93.186000 1 543 1 chr7D.!!$R1 542
4 TraesCS7A01G410600 chr5B 410217115 410218045 930 False 390.933333 865 93.387333 1955 2789 3 chr5B.!!$F2 834
5 TraesCS7A01G410600 chr2B 160473721 160474664 943 False 394.833333 856 92.492667 1944 2789 3 chr2B.!!$F1 845
6 TraesCS7A01G410600 chr3A 704961163 704961702 539 False 806.000000 806 93.554000 1 543 1 chr3A.!!$F1 542
7 TraesCS7A01G410600 chrUn 356095766 356096307 541 False 793.000000 793 93.015000 1 544 1 chrUn.!!$F2 543
8 TraesCS7A01G410600 chrUn 356141228 356141769 541 False 793.000000 793 93.015000 1 544 1 chrUn.!!$F3 543
9 TraesCS7A01G410600 chr1A 291558647 291559188 541 False 793.000000 793 93.015000 1 544 1 chr1A.!!$F1 543
10 TraesCS7A01G410600 chr3D 604121235 604121775 540 False 791.000000 791 93.002000 1 543 1 chr3D.!!$F2 542
11 TraesCS7A01G410600 chr6D 393923938 393924479 541 False 787.000000 787 92.831000 1 544 1 chr6D.!!$F1 543
12 TraesCS7A01G410600 chr6B 130976901 130977441 540 True 785.000000 785 92.818000 1 543 1 chr6B.!!$R1 542

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
659 660 1.189524 ATCCGTCTGGTCGACCCAAA 61.19 55.0 31.19 14.02 44.65 3.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1898 1916 0.838987 TGGAGGCCGAGGGTTTAACT 60.839 55.0 0.0 0.0 0.0 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 4.283722 AGAGTTCACCGTAATTTCTCTGGT 59.716 41.667 0.00 0.00 31.03 4.00
32 33 3.514309 ACCGTAATTTCTCTGGTACTGCT 59.486 43.478 0.00 0.00 0.00 4.24
104 105 4.129380 CGTGCATCTCCCATTGATTCTAA 58.871 43.478 0.00 0.00 0.00 2.10
514 515 6.699642 GGCACTTGACTTCAGATATTAGAGAC 59.300 42.308 0.00 0.00 0.00 3.36
611 612 2.186903 CCCGTTAGGCGCATCTGT 59.813 61.111 10.83 0.00 39.71 3.41
612 613 1.883084 CCCGTTAGGCGCATCTGTC 60.883 63.158 10.83 0.00 39.71 3.51
651 652 2.094659 CACGTGCATCCGTCTGGTC 61.095 63.158 0.82 0.00 39.45 4.02
659 660 1.189524 ATCCGTCTGGTCGACCCAAA 61.190 55.000 31.19 14.02 44.65 3.28
711 712 6.093771 TCTGTTTGGATCGACTACTCTAAGTC 59.906 42.308 0.00 0.00 42.09 3.01
737 738 2.202440 CTAGGACACGCACGGTCG 60.202 66.667 0.00 0.00 36.12 4.79
759 760 3.302740 GCAGGATTCTAAGCGATCAAACG 60.303 47.826 0.00 0.00 0.00 3.60
970 971 1.352352 CAGTTGGTTCCACTCCTCCAT 59.648 52.381 0.00 0.00 0.00 3.41
1721 1732 2.626780 GGTTCGTCCTGGGCTTTGC 61.627 63.158 0.00 0.00 0.00 3.68
1917 1935 0.838987 AGTTAAACCCTCGGCCTCCA 60.839 55.000 0.00 0.00 0.00 3.86
1938 1956 5.011023 TCCACATCAATCGATACATACAGCT 59.989 40.000 0.00 0.00 0.00 4.24
2410 2431 7.680730 AGTTAATACAGGATTCGCCAGATTAT 58.319 34.615 0.00 0.00 40.02 1.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 5.378230 AGTTAGAATCAATGGGAGATGCA 57.622 39.130 0.00 0.00 0.00 3.96
143 144 9.667107 TTTACGAGAAATAGAGGTCAATCAAAT 57.333 29.630 0.00 0.00 0.00 2.32
681 682 1.340248 AGTCGATCCAAACAGACACGT 59.660 47.619 0.00 0.00 36.18 4.49
711 712 2.729882 GTGCGTGTCCTAGTGTAAGTTG 59.270 50.000 0.00 0.00 0.00 3.16
737 738 3.302740 CGTTTGATCGCTTAGAATCCTGC 60.303 47.826 0.00 0.00 0.00 4.85
798 799 6.485984 TGGTACAAAAGGAAACGTTTATAGCA 59.514 34.615 14.65 10.22 43.37 3.49
970 971 2.296190 ACATTGTCTCAGACGTGCTACA 59.704 45.455 9.34 0.00 34.95 2.74
1660 1671 1.026182 TCGCCGCTGATTTGCATTCT 61.026 50.000 0.00 0.00 0.00 2.40
1721 1732 1.221021 GGGAAGTAGAAGGCCACCG 59.779 63.158 5.01 0.00 0.00 4.94
1898 1916 0.838987 TGGAGGCCGAGGGTTTAACT 60.839 55.000 0.00 0.00 0.00 2.24
1917 1935 8.060931 AGATAGCTGTATGTATCGATTGATGT 57.939 34.615 1.71 0.00 35.99 3.06
2581 2618 6.435277 ACATTGGTATGCTCAAAATTCTCACT 59.565 34.615 0.00 0.00 35.03 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.