Multiple sequence alignment - TraesCS7A01G397400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G397400 chr7A 100.000 2357 0 0 1 2357 576140636 576142992 0.000000e+00 4353.0
1 TraesCS7A01G397400 chr7A 96.223 2383 48 11 1 2357 658830976 658828610 0.000000e+00 3864.0
2 TraesCS7A01G397400 chr7A 93.465 1316 44 16 1056 2357 576226049 576227336 0.000000e+00 1916.0
3 TraesCS7A01G397400 chr7A 89.716 739 60 8 1010 1737 658809015 658808282 0.000000e+00 929.0
4 TraesCS7A01G397400 chr7A 89.488 742 58 11 1010 1737 658784146 658783411 0.000000e+00 920.0
5 TraesCS7A01G397400 chr7A 87.838 740 64 13 1010 1737 576168158 576168883 0.000000e+00 845.0
6 TraesCS7A01G397400 chr7A 89.286 672 57 8 1010 1670 576232656 576233323 0.000000e+00 828.0
7 TraesCS7A01G397400 chr7A 93.296 179 12 0 2179 2357 576169227 576169405 4.990000e-67 265.0
8 TraesCS7A01G397400 chr7A 82.334 317 40 10 2044 2357 575443557 575443254 6.460000e-66 261.0
9 TraesCS7A01G397400 chr7A 92.737 179 13 0 2179 2357 576233912 576234090 2.320000e-65 259.0
10 TraesCS7A01G397400 chr7A 92.737 179 13 0 2179 2357 658793859 658793681 2.320000e-65 259.0
11 TraesCS7A01G397400 chr7A 89.831 59 6 0 1830 1888 575444409 575444351 2.510000e-10 76.8
12 TraesCS7A01G397400 chr7B 92.912 2229 91 11 150 2357 625983362 625981180 0.000000e+00 3179.0
13 TraesCS7A01G397400 chr7B 82.754 1380 138 45 1011 2339 625972146 625970816 0.000000e+00 1138.0
14 TraesCS7A01G397400 chr7B 82.741 1379 140 51 1011 2339 625975319 625973989 0.000000e+00 1138.0
15 TraesCS7A01G397400 chr7B 89.542 153 12 1 6 154 625990066 625989914 8.600000e-45 191.0
16 TraesCS7A01G397400 chr7D 89.479 1017 79 6 1 1012 569709048 569708055 0.000000e+00 1260.0
17 TraesCS7A01G397400 chr7D 90.601 766 53 3 150 914 569455631 569454884 0.000000e+00 998.0
18 TraesCS7A01G397400 chr7D 89.185 675 55 9 1010 1670 569403756 569403086 0.000000e+00 826.0
19 TraesCS7A01G397400 chr7D 90.506 158 11 1 1 154 569462320 569462163 3.070000e-49 206.0
20 TraesCS7A01G397400 chr7D 90.385 156 10 4 1585 1737 569706271 569706118 1.430000e-47 200.0
21 TraesCS7A01G397400 chr7D 86.275 153 17 3 1585 1737 570235862 570235714 1.870000e-36 163.0
22 TraesCS7A01G397400 chr7D 86.179 123 16 1 1755 1876 570233816 570233694 5.290000e-27 132.0
23 TraesCS7A01G397400 chr7D 91.781 73 5 1 1758 1830 569402875 569402804 1.490000e-17 100.0
24 TraesCS7A01G397400 chr7D 90.164 61 6 0 1828 1888 570235606 570235546 1.940000e-11 80.5
25 TraesCS7A01G397400 chr2D 83.824 68 9 2 194 260 122701109 122701043 1.960000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G397400 chr7A 576140636 576142992 2356 False 4353.0 4353 100.0000 1 2357 1 chr7A.!!$F1 2356
1 TraesCS7A01G397400 chr7A 658828610 658830976 2366 True 3864.0 3864 96.2230 1 2357 1 chr7A.!!$R4 2356
2 TraesCS7A01G397400 chr7A 576226049 576227336 1287 False 1916.0 1916 93.4650 1056 2357 1 chr7A.!!$F2 1301
3 TraesCS7A01G397400 chr7A 658808282 658809015 733 True 929.0 929 89.7160 1010 1737 1 chr7A.!!$R3 727
4 TraesCS7A01G397400 chr7A 658783411 658784146 735 True 920.0 920 89.4880 1010 1737 1 chr7A.!!$R1 727
5 TraesCS7A01G397400 chr7A 576168158 576169405 1247 False 555.0 845 90.5670 1010 2357 2 chr7A.!!$F3 1347
6 TraesCS7A01G397400 chr7A 576232656 576234090 1434 False 543.5 828 91.0115 1010 2357 2 chr7A.!!$F4 1347
7 TraesCS7A01G397400 chr7B 625981180 625983362 2182 True 3179.0 3179 92.9120 150 2357 1 chr7B.!!$R1 2207
8 TraesCS7A01G397400 chr7B 625970816 625975319 4503 True 1138.0 1138 82.7475 1011 2339 2 chr7B.!!$R3 1328
9 TraesCS7A01G397400 chr7D 569454884 569455631 747 True 998.0 998 90.6010 150 914 1 chr7D.!!$R1 764
10 TraesCS7A01G397400 chr7D 569706118 569709048 2930 True 730.0 1260 89.9320 1 1737 2 chr7D.!!$R4 1736
11 TraesCS7A01G397400 chr7D 569402804 569403756 952 True 463.0 826 90.4830 1010 1830 2 chr7D.!!$R3 820

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
159 167 0.034896 GTCATGGTGGAGACGTTGGT 59.965 55.000 0.00 0.00 0.0 3.67 F
188 196 1.342496 TCTCCGCATTCCAGATGCTAG 59.658 52.381 9.07 6.65 42.5 3.42 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1209 2400 1.906824 GACCCTCTCGTGGTGGTCA 60.907 63.158 16.41 0.0 45.29 4.02 R
2172 7125 1.518367 TCACCCCCTGAACTCTTGTT 58.482 50.000 0.00 0.0 39.42 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 167 0.034896 GTCATGGTGGAGACGTTGGT 59.965 55.000 0.00 0.00 0.00 3.67
188 196 1.342496 TCTCCGCATTCCAGATGCTAG 59.658 52.381 9.07 6.65 42.50 3.42
317 326 7.099764 GGTATCGTGGATGAGATGTATGATTT 58.900 38.462 0.00 0.00 0.00 2.17
463 472 2.931969 CAGCAGCTTCACATCGTTCATA 59.068 45.455 0.00 0.00 0.00 2.15
465 474 2.932614 GCAGCTTCACATCGTTCATACT 59.067 45.455 0.00 0.00 0.00 2.12
745 754 5.758296 TGGATGATTGACTACGGCTAAAATC 59.242 40.000 0.00 0.00 0.00 2.17
748 757 7.012421 GGATGATTGACTACGGCTAAAATCTTT 59.988 37.037 0.00 0.00 0.00 2.52
938 953 2.766263 ACACCAGACATCACGTATCCAT 59.234 45.455 0.00 0.00 0.00 3.41
1143 2252 1.376037 CGAGTGGGACAAGAAGCCC 60.376 63.158 0.00 0.00 44.16 5.19
1209 2400 3.706373 ACCATCAAGGCCGAGCGT 61.706 61.111 0.00 0.00 43.14 5.07
1361 2713 3.067461 AGCGACGAAGAAGCTTGATCTAT 59.933 43.478 2.10 0.00 40.12 1.98
1582 2960 5.899120 ATCTCTCTGTTACGTTGCTCTTA 57.101 39.130 0.00 0.00 0.00 2.10
1744 6461 7.596995 CCTCCACTATCACGAATAAAGATTCTC 59.403 40.741 0.00 0.00 39.56 2.87
1745 6462 8.007405 TCCACTATCACGAATAAAGATTCTCA 57.993 34.615 0.00 0.00 39.56 3.27
2021 6966 6.430864 TGCCTTACAATCCATATTTCCTTCA 58.569 36.000 0.00 0.00 0.00 3.02
2268 7221 4.877378 ACACCATGATTTGCACTTTCAT 57.123 36.364 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
188 196 3.686726 CAGGTTGTACCATTGCTCTCTTC 59.313 47.826 0.00 0.0 41.95 2.87
410 419 1.089112 TTCTCGTCCGCGATCAACTA 58.911 50.000 8.23 0.0 46.80 2.24
414 423 2.099638 CGTTCTCGTCCGCGATCA 59.900 61.111 8.23 0.0 46.80 2.92
715 724 2.159156 CGTAGTCAATCATCCAACCCGA 60.159 50.000 0.00 0.0 0.00 5.14
1192 2383 3.706373 ACGCTCGGCCTTGATGGT 61.706 61.111 0.00 0.0 38.35 3.55
1209 2400 1.906824 GACCCTCTCGTGGTGGTCA 60.907 63.158 16.41 0.0 45.29 4.02
1361 2713 9.702494 CACATTAGATAGATAGATGTTGCTCAA 57.298 33.333 0.00 0.0 0.00 3.02
1582 2960 6.729428 AGACCTCCAAAATGATTCAGATTCT 58.271 36.000 0.00 0.0 0.00 2.40
1753 6470 3.858247 AGGTAAGTGGACTTATTCGTGC 58.142 45.455 2.65 0.0 40.20 5.34
1841 6786 5.669357 GCAATTACAAATCAACAGCATGCAC 60.669 40.000 21.98 0.0 42.53 4.57
2172 7125 1.518367 TCACCCCCTGAACTCTTGTT 58.482 50.000 0.00 0.0 39.42 2.83
2268 7221 4.321601 CCTTGCGGTCAAAATAAACCATCA 60.322 41.667 0.00 0.0 35.13 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.