Multiple sequence alignment - TraesCS7A01G397100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G397100 chr7A 100.000 2417 0 0 1 2417 576060949 576063365 0.000000e+00 4464.0
1 TraesCS7A01G397100 chr7A 99.299 2425 5 4 1 2417 575932810 575930390 0.000000e+00 4373.0
2 TraesCS7A01G397100 chr7A 97.967 787 8 2 1 779 575739573 575740359 0.000000e+00 1358.0
3 TraesCS7A01G397100 chr7A 97.347 603 14 1 772 1374 575745492 575746092 0.000000e+00 1024.0
4 TraesCS7A01G397100 chr7A 98.205 390 7 0 1046 1435 575736740 575737129 0.000000e+00 682.0
5 TraesCS7A01G397100 chr7A 97.692 390 9 0 1046 1435 575949659 575949270 0.000000e+00 671.0
6 TraesCS7A01G397100 chr7A 95.052 384 13 4 1046 1429 658891626 658892003 1.240000e-167 599.0
7 TraesCS7A01G397100 chr7A 94.792 384 14 4 1046 1429 576118461 576118084 5.750000e-166 593.0
8 TraesCS7A01G397100 chr7A 82.290 559 78 15 1044 1596 658910635 658910092 4.710000e-127 464.0
9 TraesCS7A01G397100 chr7A 82.290 559 78 15 1044 1596 658959942 658959399 4.710000e-127 464.0
10 TraesCS7A01G397100 chr7A 91.892 185 14 1 2231 2414 575443407 575443591 8.570000e-65 257.0
11 TraesCS7A01G397100 chr7D 95.109 736 29 3 1 730 570230768 570231502 0.000000e+00 1153.0
12 TraesCS7A01G397100 chr7D 89.631 868 56 12 880 1742 570231500 570232338 0.000000e+00 1074.0
13 TraesCS7A01G397100 chr7D 97.959 294 4 2 2124 2417 570233256 570233547 2.140000e-140 508.0
14 TraesCS7A01G397100 chr7D 96.957 230 6 1 1896 2125 570232995 570233223 3.770000e-103 385.0
15 TraesCS7A01G397100 chr7D 81.383 188 21 8 2231 2417 570234111 570234285 9.010000e-30 141.0
16 TraesCS7A01G397100 chr7D 90.698 86 7 1 317 401 454401344 454401259 1.960000e-21 113.0
17 TraesCS7A01G397100 chr6A 90.794 315 28 1 1 314 586875491 586875805 1.030000e-113 420.0
18 TraesCS7A01G397100 chr7B 89.968 309 29 2 1 307 689432563 689432871 4.840000e-107 398.0
19 TraesCS7A01G397100 chr1B 89.524 315 32 1 1 314 320995301 320994987 4.840000e-107 398.0
20 TraesCS7A01G397100 chr4A 91.860 86 5 2 318 401 323790394 323790309 4.220000e-23 119.0
21 TraesCS7A01G397100 chr4A 90.588 85 7 1 318 401 174717946 174718030 7.060000e-21 111.0
22 TraesCS7A01G397100 chr3B 91.765 85 6 1 318 401 617253775 617253859 1.520000e-22 117.0
23 TraesCS7A01G397100 chr5A 90.698 86 6 2 318 401 556390253 556390338 1.960000e-21 113.0
24 TraesCS7A01G397100 chr1A 91.463 82 5 2 322 401 465276579 465276498 7.060000e-21 111.0
25 TraesCS7A01G397100 chr5D 96.000 50 2 0 474 523 45130324 45130275 5.540000e-12 82.4
26 TraesCS7A01G397100 chr5D 92.308 39 2 1 540 577 404237053 404237015 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G397100 chr7A 576060949 576063365 2416 False 4464.0 4464 100.0000 1 2417 1 chr7A.!!$F3 2416
1 TraesCS7A01G397100 chr7A 575930390 575932810 2420 True 4373.0 4373 99.2990 1 2417 1 chr7A.!!$R1 2416
2 TraesCS7A01G397100 chr7A 575745492 575746092 600 False 1024.0 1024 97.3470 772 1374 1 chr7A.!!$F2 602
3 TraesCS7A01G397100 chr7A 575736740 575740359 3619 False 1020.0 1358 98.0860 1 1435 2 chr7A.!!$F5 1434
4 TraesCS7A01G397100 chr7A 658910092 658910635 543 True 464.0 464 82.2900 1044 1596 1 chr7A.!!$R4 552
5 TraesCS7A01G397100 chr7A 658959399 658959942 543 True 464.0 464 82.2900 1044 1596 1 chr7A.!!$R5 552
6 TraesCS7A01G397100 chr7D 570230768 570234285 3517 False 652.2 1153 92.2078 1 2417 5 chr7D.!!$F1 2416

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
370 371 5.395642 CCCTTTATTTTAACATCAACGCGT 58.604 37.5 5.58 5.58 0.0 6.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2097 5428 6.43 GCCAATCCTCTGTCTTTACTTGTTTA 59.57 38.462 0.0 0.0 0.0 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
103 104 6.849588 TCATGTTATGAGCACATACATGTC 57.150 37.5 26.09 11.16 41.78 3.06
370 371 5.395642 CCCTTTATTTTAACATCAACGCGT 58.604 37.5 5.58 5.58 0.00 6.01
2179 5547 5.128663 GGTGGTATTTTTGGTGGATTGCTAT 59.871 40.0 0.00 0.00 0.00 2.97
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
103 104 5.062058 CGGCAACTTTTATGCATACCTTTTG 59.938 40.000 5.74 9.03 45.6 2.44
226 227 5.220322 CGCACCTTGTTGTTTTAAAAGTTCC 60.220 40.000 0.00 0.00 0.0 3.62
2095 5426 9.014297 CCAATCCTCTGTCTTTACTTGTTTATT 57.986 33.333 0.00 0.00 0.0 1.40
2096 5427 7.121315 GCCAATCCTCTGTCTTTACTTGTTTAT 59.879 37.037 0.00 0.00 0.0 1.40
2097 5428 6.430000 GCCAATCCTCTGTCTTTACTTGTTTA 59.570 38.462 0.00 0.00 0.0 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.