Multiple sequence alignment - TraesCS7A01G387900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G387900 chr7A 100.000 2357 0 0 1 2357 563531481 563529125 0.000000e+00 4353.0
1 TraesCS7A01G387900 chr3A 98.388 2358 37 1 1 2357 191855549 191857906 0.000000e+00 4143.0
2 TraesCS7A01G387900 chr1A 98.008 2359 45 2 1 2357 278506346 278508704 0.000000e+00 4095.0
3 TraesCS7A01G387900 chr1A 98.725 1883 23 1 1 1882 238109745 238107863 0.000000e+00 3343.0
4 TraesCS7A01G387900 chr1A 98.672 1883 24 1 1 1882 238155130 238153248 0.000000e+00 3338.0
5 TraesCS7A01G387900 chr7D 98.991 1883 18 1 1 1882 579015578 579017460 0.000000e+00 3371.0
6 TraesCS7A01G387900 chr7D 97.403 77 2 0 2281 2357 382095732 382095808 5.290000e-27 132.0
7 TraesCS7A01G387900 chrUn 98.832 1883 18 2 1 1882 237257830 237255951 0.000000e+00 3352.0
8 TraesCS7A01G387900 chrUn 97.403 77 2 0 2281 2357 325544762 325544686 5.290000e-27 132.0
9 TraesCS7A01G387900 chrUn 97.403 77 2 0 2281 2357 325547858 325547782 5.290000e-27 132.0
10 TraesCS7A01G387900 chrUn 97.403 77 2 0 2281 2357 369393938 369394014 5.290000e-27 132.0
11 TraesCS7A01G387900 chr5A 98.566 1883 26 1 1 1882 16577920 16576038 0.000000e+00 3326.0
12 TraesCS7A01G387900 chr6B 98.460 1883 27 2 1 1882 596657306 596655425 0.000000e+00 3315.0
13 TraesCS7A01G387900 chr4D 98.104 1899 34 2 1 1898 483696359 483698256 0.000000e+00 3306.0
14 TraesCS7A01G387900 chr4A 96.267 509 18 1 1849 2357 275502889 275502382 0.000000e+00 833.0
15 TraesCS7A01G387900 chr2A 98.431 255 4 0 1797 2051 588457946 588458200 1.280000e-122 449.0
16 TraesCS7A01G387900 chr1D 92.982 285 19 1 2071 2355 461637087 461636804 4.690000e-112 414.0
17 TraesCS7A01G387900 chr1D 95.556 45 2 0 2257 2301 316339437 316339481 3.250000e-09 73.1
18 TraesCS7A01G387900 chr7B 96.639 119 4 0 2102 2220 740000501 740000383 5.140000e-47 198.0
19 TraesCS7A01G387900 chr3D 97.403 77 2 0 2281 2357 501844032 501844108 5.290000e-27 132.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G387900 chr7A 563529125 563531481 2356 True 4353 4353 100.000 1 2357 1 chr7A.!!$R1 2356
1 TraesCS7A01G387900 chr3A 191855549 191857906 2357 False 4143 4143 98.388 1 2357 1 chr3A.!!$F1 2356
2 TraesCS7A01G387900 chr1A 278506346 278508704 2358 False 4095 4095 98.008 1 2357 1 chr1A.!!$F1 2356
3 TraesCS7A01G387900 chr1A 238107863 238109745 1882 True 3343 3343 98.725 1 1882 1 chr1A.!!$R1 1881
4 TraesCS7A01G387900 chr1A 238153248 238155130 1882 True 3338 3338 98.672 1 1882 1 chr1A.!!$R2 1881
5 TraesCS7A01G387900 chr7D 579015578 579017460 1882 False 3371 3371 98.991 1 1882 1 chr7D.!!$F2 1881
6 TraesCS7A01G387900 chrUn 237255951 237257830 1879 True 3352 3352 98.832 1 1882 1 chrUn.!!$R1 1881
7 TraesCS7A01G387900 chr5A 16576038 16577920 1882 True 3326 3326 98.566 1 1882 1 chr5A.!!$R1 1881
8 TraesCS7A01G387900 chr6B 596655425 596657306 1881 True 3315 3315 98.460 1 1882 1 chr6B.!!$R1 1881
9 TraesCS7A01G387900 chr4D 483696359 483698256 1897 False 3306 3306 98.104 1 1898 1 chr4D.!!$F1 1897
10 TraesCS7A01G387900 chr4A 275502382 275502889 507 True 833 833 96.267 1849 2357 1 chr4A.!!$R1 508

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
683 684 1.883732 CGGCTCTCGGTTCTTGAGA 59.116 57.895 0.0 0.0 40.07 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2220 2226 2.430382 ATCGACGAAGGCCACACGTT 62.43 55.0 19.3 0.0 40.29 3.99 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
508 509 3.781760 ACGGAAGTAGAACGGGCA 58.218 55.556 0.00 0.0 46.88 5.36
616 617 2.031120 CCTTTCTTGTTCTTGGTGGCA 58.969 47.619 0.00 0.0 0.00 4.92
683 684 1.883732 CGGCTCTCGGTTCTTGAGA 59.116 57.895 0.00 0.0 40.07 3.27
926 927 2.419297 GGTTCGAATCCACATCTGAGCT 60.419 50.000 0.00 0.0 0.00 4.09
1154 1157 2.134287 CCGATCCCTCCGGTGATGT 61.134 63.158 4.76 0.0 41.91 3.06
1266 1269 7.201920 GCAGTACCTCCTAACAAGATTGATCTA 60.202 40.741 0.00 0.0 35.76 1.98
1310 1313 5.923684 TGGCCTTTTTATTGATTTTGACGAC 59.076 36.000 3.32 0.0 0.00 4.34
1349 1352 0.404040 AAAAGGGGTGCTTCGGATCA 59.596 50.000 0.00 0.0 0.00 2.92
1882 1888 4.407296 ACCATTTCTCTCCGCTATTCTTCT 59.593 41.667 0.00 0.0 0.00 2.85
2150 2156 2.321719 TGGGATCATCGGGTCGAATAA 58.678 47.619 0.00 0.0 39.99 1.40
2151 2157 2.903784 TGGGATCATCGGGTCGAATAAT 59.096 45.455 0.00 0.0 39.99 1.28
2152 2158 4.090819 TGGGATCATCGGGTCGAATAATA 58.909 43.478 0.00 0.0 39.99 0.98
2156 2162 1.990563 CATCGGGTCGAATAATACCGC 59.009 52.381 0.00 0.0 43.93 5.68
2220 2226 3.497942 GGTCTTTAAAAGGGCTGTGAGGA 60.498 47.826 0.00 0.0 0.00 3.71
2284 2290 6.403866 ACAAATCCACTAGCATTTTGTTCA 57.596 33.333 7.48 0.0 37.24 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
508 509 3.587797 TTCTCTCACGTAATTTCGCCT 57.412 42.857 4.22 0.00 0.00 5.52
683 684 1.377994 CCTGCAGTGGAGGAGCTTT 59.622 57.895 25.63 0.00 31.48 3.51
975 977 1.048601 AAGCCCACTTCGTTCTCTCA 58.951 50.000 0.00 0.00 0.00 3.27
1042 1045 4.894784 AGTGGAATCAAAGAAACTAGCGA 58.105 39.130 0.00 0.00 0.00 4.93
1154 1157 5.723492 TCGTATATCGAAACGACTTCTGA 57.277 39.130 14.57 0.00 45.98 3.27
1310 1313 6.935771 CCTTTTCCATTCATAGAGAGATCCAG 59.064 42.308 0.00 0.00 0.00 3.86
1349 1352 4.470602 CCCTTTCAAAAGTGGTTACTCCT 58.529 43.478 2.09 0.00 35.69 3.69
1459 1462 3.319405 ACATTGATCCGAAGCTCGAGTAT 59.681 43.478 15.13 2.74 43.74 2.12
1882 1888 3.162666 TCGTTCTCAAGCCCTTCTAAGA 58.837 45.455 0.00 0.00 0.00 2.10
2220 2226 2.430382 ATCGACGAAGGCCACACGTT 62.430 55.000 19.30 0.00 40.29 3.99
2258 2264 8.584157 TGAACAAAATGCTAGTGGATTTGTAAT 58.416 29.630 14.17 4.90 42.13 1.89
2284 2290 8.594687 CAACGAAAAACAAGAACATTCTTTCAT 58.405 29.630 4.08 0.00 44.70 2.57
2324 2330 8.437274 AGAAAGGGAGACTTAGTTTTAGATCA 57.563 34.615 0.00 0.00 38.85 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.