Multiple sequence alignment - TraesCS7A01G387800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G387800 chr7A 100.000 2378 0 0 1 2378 563531080 563528703 0.000000e+00 4392.0
1 TraesCS7A01G387800 chr3A 98.188 1987 35 1 1 1986 191855950 191857936 0.000000e+00 3469.0
2 TraesCS7A01G387800 chr3A 96.025 478 16 2 1903 2378 51895119 51895595 0.000000e+00 774.0
3 TraesCS7A01G387800 chr1A 97.722 1975 43 2 1 1973 278506747 278508721 0.000000e+00 3397.0
4 TraesCS7A01G387800 chr1A 98.448 1482 22 1 1 1481 238109344 238107863 0.000000e+00 2608.0
5 TraesCS7A01G387800 chr1A 98.448 1482 22 1 1 1481 238154729 238153248 0.000000e+00 2608.0
6 TraesCS7A01G387800 chr7D 98.785 1482 17 1 1 1481 579015979 579017460 0.000000e+00 2636.0
7 TraesCS7A01G387800 chr7D 92.231 502 34 3 1880 2377 382095732 382096232 0.000000e+00 706.0
8 TraesCS7A01G387800 chr7D 91.068 515 28 4 1880 2377 44761708 44761195 0.000000e+00 680.0
9 TraesCS7A01G387800 chrUn 98.718 1482 15 2 1 1481 237257429 237255951 0.000000e+00 2628.0
10 TraesCS7A01G387800 chr6B 98.379 1481 23 1 1 1481 394497044 394498523 0.000000e+00 2601.0
11 TraesCS7A01G387800 chr5A 98.313 1482 24 1 1 1481 16577519 16576038 0.000000e+00 2597.0
12 TraesCS7A01G387800 chr4D 97.797 1498 31 2 1 1497 483696760 483698256 0.000000e+00 2582.0
13 TraesCS7A01G387800 chr4A 95.936 935 31 4 1448 2378 275502889 275501958 0.000000e+00 1509.0
14 TraesCS7A01G387800 chr4A 93.613 501 28 3 1880 2377 290910283 290910782 0.000000e+00 745.0
15 TraesCS7A01G387800 chr4A 86.004 493 53 10 1895 2375 350249147 350248659 4.530000e-142 514.0
16 TraesCS7A01G387800 chr3D 93.800 500 27 4 1880 2377 501844032 501844529 0.000000e+00 749.0
17 TraesCS7A01G387800 chr3D 93.587 499 27 4 1880 2377 523747102 523746608 0.000000e+00 739.0
18 TraesCS7A01G387800 chr7B 97.688 346 7 1 2033 2378 716903776 716904120 5.660000e-166 593.0
19 TraesCS7A01G387800 chr7B 96.639 119 4 0 1701 1819 740000501 740000383 5.180000e-47 198.0
20 TraesCS7A01G387800 chr2A 98.431 255 4 0 1396 1650 588457946 588458200 1.300000e-122 449.0
21 TraesCS7A01G387800 chr1D 91.798 317 22 2 1670 1986 461637087 461636775 2.810000e-119 438.0
22 TraesCS7A01G387800 chr1D 95.556 45 2 0 1856 1900 316339437 316339481 3.280000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G387800 chr7A 563528703 563531080 2377 True 4392 4392 100.000 1 2378 1 chr7A.!!$R1 2377
1 TraesCS7A01G387800 chr3A 191855950 191857936 1986 False 3469 3469 98.188 1 1986 1 chr3A.!!$F2 1985
2 TraesCS7A01G387800 chr1A 278506747 278508721 1974 False 3397 3397 97.722 1 1973 1 chr1A.!!$F1 1972
3 TraesCS7A01G387800 chr1A 238107863 238109344 1481 True 2608 2608 98.448 1 1481 1 chr1A.!!$R1 1480
4 TraesCS7A01G387800 chr1A 238153248 238154729 1481 True 2608 2608 98.448 1 1481 1 chr1A.!!$R2 1480
5 TraesCS7A01G387800 chr7D 579015979 579017460 1481 False 2636 2636 98.785 1 1481 1 chr7D.!!$F2 1480
6 TraesCS7A01G387800 chr7D 382095732 382096232 500 False 706 706 92.231 1880 2377 1 chr7D.!!$F1 497
7 TraesCS7A01G387800 chr7D 44761195 44761708 513 True 680 680 91.068 1880 2377 1 chr7D.!!$R1 497
8 TraesCS7A01G387800 chrUn 237255951 237257429 1478 True 2628 2628 98.718 1 1481 1 chrUn.!!$R1 1480
9 TraesCS7A01G387800 chr6B 394497044 394498523 1479 False 2601 2601 98.379 1 1481 1 chr6B.!!$F1 1480
10 TraesCS7A01G387800 chr5A 16576038 16577519 1481 True 2597 2597 98.313 1 1481 1 chr5A.!!$R1 1480
11 TraesCS7A01G387800 chr4D 483696760 483698256 1496 False 2582 2582 97.797 1 1497 1 chr4D.!!$F1 1496
12 TraesCS7A01G387800 chr4A 275501958 275502889 931 True 1509 1509 95.936 1448 2378 1 chr4A.!!$R1 930

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
948 952 0.40404 AAAAGGGGTGCTTCGGATCA 59.596 50.0 0.0 0.0 0.0 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2030 2038 0.034896 ACGACGCTGGGTCAAATTCT 59.965 50.0 22.32 0.0 46.42 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 3.781760 ACGGAAGTAGAACGGGCA 58.218 55.556 0.00 0.00 46.88 5.36
215 216 2.031120 CCTTTCTTGTTCTTGGTGGCA 58.969 47.619 0.00 0.00 0.00 4.92
282 283 1.883732 CGGCTCTCGGTTCTTGAGA 59.116 57.895 0.00 0.00 40.07 3.27
525 526 2.419297 GGTTCGAATCCACATCTGAGCT 60.419 50.000 0.00 0.00 0.00 4.09
753 757 2.134287 CCGATCCCTCCGGTGATGT 61.134 63.158 4.76 0.00 41.91 3.06
865 869 7.201920 GCAGTACCTCCTAACAAGATTGATCTA 60.202 40.741 0.00 0.00 35.76 1.98
909 913 5.923684 TGGCCTTTTTATTGATTTTGACGAC 59.076 36.000 3.32 0.00 0.00 4.34
948 952 0.404040 AAAAGGGGTGCTTCGGATCA 59.596 50.000 0.00 0.00 0.00 2.92
1481 1485 4.407296 ACCATTTCTCTCCGCTATTCTTCT 59.593 41.667 0.00 0.00 0.00 2.85
1749 1753 2.321719 TGGGATCATCGGGTCGAATAA 58.678 47.619 0.00 0.00 39.99 1.40
1750 1754 2.903784 TGGGATCATCGGGTCGAATAAT 59.096 45.455 0.00 0.00 39.99 1.28
1751 1755 4.090819 TGGGATCATCGGGTCGAATAATA 58.909 43.478 0.00 0.00 39.99 0.98
1755 1759 1.990563 CATCGGGTCGAATAATACCGC 59.009 52.381 0.00 0.00 43.93 5.68
1819 1823 3.497942 GGTCTTTAAAAGGGCTGTGAGGA 60.498 47.826 0.00 0.00 0.00 3.71
1883 1887 6.403866 ACAAATCCACTAGCATTTTGTTCA 57.596 33.333 7.48 0.00 37.24 3.18
1976 1980 1.609208 TGGGAGCAGAGCTGAAAAAC 58.391 50.000 0.85 0.00 39.88 2.43
2030 2038 1.093972 CAATGGACGGCATGCTTGTA 58.906 50.000 18.92 3.23 0.00 2.41
2065 2073 2.030457 CGTCGTCATACCCAAATTCTGC 59.970 50.000 0.00 0.00 0.00 4.26
2085 2093 2.756042 AATGGGCCGGCTATGAGCA 61.756 57.895 28.56 0.00 44.75 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 3.587797 TTCTCTCACGTAATTTCGCCT 57.412 42.857 4.22 0.00 0.00 5.52
282 283 1.377994 CCTGCAGTGGAGGAGCTTT 59.622 57.895 25.63 0.00 31.48 3.51
574 577 1.048601 AAGCCCACTTCGTTCTCTCA 58.951 50.000 0.00 0.00 0.00 3.27
641 645 4.894784 AGTGGAATCAAAGAAACTAGCGA 58.105 39.130 0.00 0.00 0.00 4.93
753 757 5.723492 TCGTATATCGAAACGACTTCTGA 57.277 39.130 14.57 0.00 45.98 3.27
909 913 6.935771 CCTTTTCCATTCATAGAGAGATCCAG 59.064 42.308 0.00 0.00 0.00 3.86
948 952 4.470602 CCCTTTCAAAAGTGGTTACTCCT 58.529 43.478 2.09 0.00 35.69 3.69
1058 1062 3.319405 ACATTGATCCGAAGCTCGAGTAT 59.681 43.478 15.13 2.74 43.74 2.12
1481 1485 3.162666 TCGTTCTCAAGCCCTTCTAAGA 58.837 45.455 0.00 0.00 0.00 2.10
1819 1823 2.430382 ATCGACGAAGGCCACACGTT 62.430 55.000 19.30 0.00 40.29 3.99
1857 1861 8.584157 TGAACAAAATGCTAGTGGATTTGTAAT 58.416 29.630 14.17 4.90 42.13 1.89
1883 1887 8.594687 CAACGAAAAACAAGAACATTCTTTCAT 58.405 29.630 4.08 0.00 44.70 2.57
1923 1927 8.437274 AGAAAGGGAGACTTAGTTTTAGATCA 57.563 34.615 0.00 0.00 38.85 2.92
1976 1980 2.430465 GATCCATCGTGATTCCCCATG 58.570 52.381 0.00 0.00 0.00 3.66
2030 2038 0.034896 ACGACGCTGGGTCAAATTCT 59.965 50.000 22.32 0.00 46.42 2.40
2065 2073 1.601759 CTCATAGCCGGCCCATTGG 60.602 63.158 26.15 7.34 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.