Multiple sequence alignment - TraesCS7A01G387700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G387700 chr7A 100.000 2465 0 0 1 2465 563523175 563520711 0 4553
1 TraesCS7A01G387700 chr3A 98.458 2465 38 0 1 2465 495105837 495103373 0 4342
2 TraesCS7A01G387700 chr2B 98.458 2465 38 0 1 2465 234542237 234539773 0 4342
3 TraesCS7A01G387700 chr3B 98.460 2467 33 3 1 2465 92297809 92295346 0 4340
4 TraesCS7A01G387700 chr3B 98.337 2465 40 1 1 2465 6011843 6009380 0 4324
5 TraesCS7A01G387700 chr4A 98.337 2465 41 0 1 2465 67518421 67520885 0 4325
6 TraesCS7A01G387700 chrUn 98.337 2465 40 1 1 2465 217906591 217909054 0 4324
7 TraesCS7A01G387700 chr6D 97.932 2466 49 2 1 2465 108484131 108486595 0 4270
8 TraesCS7A01G387700 chr1B 97.770 2466 54 1 1 2465 619196409 619193944 0 4248


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G387700 chr7A 563520711 563523175 2464 True 4553 4553 100.000 1 2465 1 chr7A.!!$R1 2464
1 TraesCS7A01G387700 chr3A 495103373 495105837 2464 True 4342 4342 98.458 1 2465 1 chr3A.!!$R1 2464
2 TraesCS7A01G387700 chr2B 234539773 234542237 2464 True 4342 4342 98.458 1 2465 1 chr2B.!!$R1 2464
3 TraesCS7A01G387700 chr3B 92295346 92297809 2463 True 4340 4340 98.460 1 2465 1 chr3B.!!$R2 2464
4 TraesCS7A01G387700 chr3B 6009380 6011843 2463 True 4324 4324 98.337 1 2465 1 chr3B.!!$R1 2464
5 TraesCS7A01G387700 chr4A 67518421 67520885 2464 False 4325 4325 98.337 1 2465 1 chr4A.!!$F1 2464
6 TraesCS7A01G387700 chrUn 217906591 217909054 2463 False 4324 4324 98.337 1 2465 1 chrUn.!!$F1 2464
7 TraesCS7A01G387700 chr6D 108484131 108486595 2464 False 4270 4270 97.932 1 2465 1 chr6D.!!$F1 2464
8 TraesCS7A01G387700 chr1B 619193944 619196409 2465 True 4248 4248 97.770 1 2465 1 chr1B.!!$R1 2464

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
689 692 1.054406 CCCCCTCCTATTCGAAGCCA 61.054 60.0 3.35 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2399 2405 0.323629 CACTTTCACTTAGGCCCGGA 59.676 55.0 0.73 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
689 692 1.054406 CCCCCTCCTATTCGAAGCCA 61.054 60.000 3.35 0.0 0.00 4.75
968 971 4.492895 GCTGTCGTAAAGTTTCGTTGTTCA 60.493 41.667 0.00 0.0 0.00 3.18
1220 1223 5.874810 TGTTGGAATTCTATGAAAGAGTCCG 59.125 40.000 5.23 0.0 40.64 4.79
1319 1322 4.852134 TTGATTCCTCCACACAACAATG 57.148 40.909 0.00 0.0 0.00 2.82
1369 1372 1.446445 TCAACCGGCAACCGTATCG 60.446 57.895 0.00 0.0 46.80 2.92
1432 1435 1.767759 AGCAAAGGATTGGGGATTCG 58.232 50.000 0.00 0.0 37.02 3.34
1850 1853 3.632643 TCTCCATATGAAAGTGCTGCA 57.367 42.857 3.65 0.0 0.00 4.41
2432 2438 3.304293 GTGAAAGTGCAAAAGTGAAGTGC 59.696 43.478 0.00 0.0 38.78 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
656 658 2.911928 GGGGGCTTAGCTCTGGAC 59.088 66.667 3.38 0.00 0.00 4.02
895 898 1.486310 ACACAAGTGCTCTCTGAACCA 59.514 47.619 0.00 0.00 0.00 3.67
968 971 2.385803 AGATAGGGTCAACGACGGAAT 58.614 47.619 0.00 0.00 32.65 3.01
1220 1223 2.203451 CATGCATCCTGGCTCCCC 60.203 66.667 0.00 0.00 34.04 4.81
1319 1322 6.143496 TCTAATTCATCGATACGAGAAGCAC 58.857 40.000 0.00 0.00 39.91 4.40
1369 1372 6.238648 CCAATATCCACTAATCGTTGTTTCCC 60.239 42.308 0.00 0.00 0.00 3.97
1432 1435 3.930848 CGACCTCTTAACATTACACCACC 59.069 47.826 0.00 0.00 0.00 4.61
1740 1743 0.605319 GGTGAACTCATGCGGTTCCA 60.605 55.000 20.55 11.24 41.42 3.53
1895 1898 0.596577 GTCACGTGACCTACAGCTCA 59.403 55.000 33.62 0.00 39.07 4.26
1995 1998 1.818959 TTCATTCGACGTTCCGGGGT 61.819 55.000 0.00 0.00 0.00 4.95
2264 2267 4.474651 TCCTTATGATCTGGTGGTTCACAT 59.525 41.667 0.00 0.00 35.86 3.21
2399 2405 0.323629 CACTTTCACTTAGGCCCGGA 59.676 55.000 0.73 0.00 0.00 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.