Multiple sequence alignment - TraesCS7A01G387600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G387600 chr7A 100.000 2192 0 0 1 2192 563522097 563519906 0.000000e+00 4048
1 TraesCS7A01G387600 chr2B 97.947 2192 45 0 1 2192 234541159 234538968 0.000000e+00 3799
2 TraesCS7A01G387600 chr2B 97.500 1960 49 0 233 2192 234502228 234500269 0.000000e+00 3349
3 TraesCS7A01G387600 chr2B 98.958 192 2 0 1 192 234502415 234502224 5.790000e-91 344
4 TraesCS7A01G387600 chr2B 84.878 205 23 7 52 248 614510096 614509892 1.330000e-47 200
5 TraesCS7A01G387600 chr3A 97.810 2192 48 0 1 2192 495104759 495102568 0.000000e+00 3783
6 TraesCS7A01G387600 chr1A 97.719 2192 49 1 1 2192 278521195 278523385 0.000000e+00 3770
7 TraesCS7A01G387600 chrUn 97.582 2192 52 1 1 2192 217907669 217909859 0.000000e+00 3753
8 TraesCS7A01G387600 chr3B 97.582 2192 52 1 1 2192 6010765 6008575 0.000000e+00 3753
9 TraesCS7A01G387600 chr3B 97.493 2194 50 3 1 2192 92296731 92294541 0.000000e+00 3742
10 TraesCS7A01G387600 chr1B 97.445 2192 55 1 1 2192 619195330 619193140 0.000000e+00 3736
11 TraesCS7A01G387600 chr4A 97.400 2192 57 0 1 2192 67519499 67521690 0.000000e+00 3733


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G387600 chr7A 563519906 563522097 2191 True 4048.0 4048 100.000 1 2192 1 chr7A.!!$R1 2191
1 TraesCS7A01G387600 chr2B 234538968 234541159 2191 True 3799.0 3799 97.947 1 2192 1 chr2B.!!$R1 2191
2 TraesCS7A01G387600 chr2B 234500269 234502415 2146 True 1846.5 3349 98.229 1 2192 2 chr2B.!!$R3 2191
3 TraesCS7A01G387600 chr3A 495102568 495104759 2191 True 3783.0 3783 97.810 1 2192 1 chr3A.!!$R1 2191
4 TraesCS7A01G387600 chr1A 278521195 278523385 2190 False 3770.0 3770 97.719 1 2192 1 chr1A.!!$F1 2191
5 TraesCS7A01G387600 chrUn 217907669 217909859 2190 False 3753.0 3753 97.582 1 2192 1 chrUn.!!$F1 2191
6 TraesCS7A01G387600 chr3B 6008575 6010765 2190 True 3753.0 3753 97.582 1 2192 1 chr3B.!!$R1 2191
7 TraesCS7A01G387600 chr3B 92294541 92296731 2190 True 3742.0 3742 97.493 1 2192 1 chr3B.!!$R2 2191
8 TraesCS7A01G387600 chr1B 619193140 619195330 2190 True 3736.0 3736 97.445 1 2192 1 chr1B.!!$R1 2191
9 TraesCS7A01G387600 chr4A 67519499 67521690 2191 False 3733.0 3733 97.400 1 2192 1 chr4A.!!$F1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
291 292 1.446445 TCAACCGGCAACCGTATCG 60.446 57.895 0.0 0.0 46.8 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1321 1324 0.323629 CACTTTCACTTAGGCCCGGA 59.676 55.0 0.73 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 143 5.874810 TGTTGGAATTCTATGAAAGAGTCCG 59.125 40.000 5.23 0.00 40.64 4.79
241 242 4.852134 TTGATTCCTCCACACAACAATG 57.148 40.909 0.00 0.00 0.00 2.82
291 292 1.446445 TCAACCGGCAACCGTATCG 60.446 57.895 0.00 0.00 46.80 2.92
354 355 1.767759 AGCAAAGGATTGGGGATTCG 58.232 50.000 0.00 0.00 37.02 3.34
772 773 3.632643 TCTCCATATGAAAGTGCTGCA 57.367 42.857 3.65 0.00 0.00 4.41
1354 1357 3.304293 GTGAAAGTGCAAAAGTGAAGTGC 59.696 43.478 0.00 0.00 38.78 4.40
1485 1488 4.155462 TCGCTATGATCGTTACTGTATCCC 59.845 45.833 0.00 0.00 0.00 3.85
1527 1530 3.507233 AGTGTTCGGATCATTGTGCAATT 59.493 39.130 0.00 0.00 0.00 2.32
1680 1683 4.100373 AGACTCAGGTTAAGCTCCATCTT 58.900 43.478 3.68 0.00 0.00 2.40
1719 1722 1.202545 GGAGTAAAGCATCCCGAGGTC 60.203 57.143 0.00 0.00 0.00 3.85
1773 1776 4.777463 GGAACCCCAATATCTTTCTTCGA 58.223 43.478 0.00 0.00 0.00 3.71
1955 1959 3.515316 CTGACACGCCGGAGTTGGT 62.515 63.158 8.62 4.21 0.00 3.67
2058 2062 0.534412 ACTGCGTCCAGGATCAGAAG 59.466 55.000 21.96 10.96 43.53 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 143 2.203451 CATGCATCCTGGCTCCCC 60.203 66.667 0.00 0.00 34.04 4.81
241 242 6.143496 TCTAATTCATCGATACGAGAAGCAC 58.857 40.000 0.00 0.00 39.91 4.40
291 292 6.238648 CCAATATCCACTAATCGTTGTTTCCC 60.239 42.308 0.00 0.00 0.00 3.97
354 355 3.930848 CGACCTCTTAACATTACACCACC 59.069 47.826 0.00 0.00 0.00 4.61
662 663 0.605319 GGTGAACTCATGCGGTTCCA 60.605 55.000 20.55 11.24 41.42 3.53
817 818 0.596577 GTCACGTGACCTACAGCTCA 59.403 55.000 33.62 0.00 39.07 4.26
917 918 1.818959 TTCATTCGACGTTCCGGGGT 61.819 55.000 0.00 0.00 0.00 4.95
1321 1324 0.323629 CACTTTCACTTAGGCCCGGA 59.676 55.000 0.73 0.00 0.00 5.14
1485 1488 4.205996 CACTTTGTCGCATCTCTTCGATAG 59.794 45.833 0.00 0.00 37.06 2.08
1680 1683 1.769295 TAACCCCACGGTGGTTCCA 60.769 57.895 24.70 5.63 43.71 3.53
1737 1740 1.342374 GGGTTCCCAATGCTTCTCCAT 60.342 52.381 2.59 0.00 0.00 3.41
1773 1776 1.954382 GGACGGGAAAAGAAACTGCTT 59.046 47.619 0.00 0.00 0.00 3.91
1811 1814 1.137513 CGAAGAACCGAAAGCGAAGT 58.862 50.000 0.00 0.00 40.82 3.01
1955 1959 0.611618 CCACCCTATTGTGCCAGCAA 60.612 55.000 0.00 0.00 34.85 3.91
2148 2152 3.478857 TTCTTTTAGTGCTTCGACCCA 57.521 42.857 0.00 0.00 0.00 4.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.