Multiple sequence alignment - TraesCS7A01G387500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G387500 chr7A 100.000 2359 0 0 1 2359 563516503 563514145 0 4357
1 TraesCS7A01G387500 chr5D 98.432 2360 32 3 1 2359 503225671 503223316 0 4148
2 TraesCS7A01G387500 chr5D 98.051 2360 43 3 1 2359 503235987 503233630 0 4100
3 TraesCS7A01G387500 chr3A 98.136 2360 39 3 1 2359 66010170 66012525 0 4109
4 TraesCS7A01G387500 chr2B 98.051 2360 42 2 1 2359 449213739 449211383 0 4100
5 TraesCS7A01G387500 chr2B 97.919 2355 42 4 6 2359 474915888 474913540 0 4071
6 TraesCS7A01G387500 chr2B 97.239 2354 49 5 7 2357 234535557 234533217 0 3973
7 TraesCS7A01G387500 chr2B 96.339 1666 55 5 1 1665 272615323 272616983 0 2734
8 TraesCS7A01G387500 chr2B 95.597 704 27 1 1656 2359 272627161 272627860 0 1125
9 TraesCS7A01G387500 chr1A 98.008 2360 43 2 1 2359 278526787 278529143 0 4095
10 TraesCS7A01G387500 chr3B 97.966 2360 46 2 1 2359 201534482 201532124 0 4091


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G387500 chr7A 563514145 563516503 2358 True 4357 4357 100.000 1 2359 1 chr7A.!!$R1 2358
1 TraesCS7A01G387500 chr5D 503223316 503225671 2355 True 4148 4148 98.432 1 2359 1 chr5D.!!$R1 2358
2 TraesCS7A01G387500 chr5D 503233630 503235987 2357 True 4100 4100 98.051 1 2359 1 chr5D.!!$R2 2358
3 TraesCS7A01G387500 chr3A 66010170 66012525 2355 False 4109 4109 98.136 1 2359 1 chr3A.!!$F1 2358
4 TraesCS7A01G387500 chr2B 449211383 449213739 2356 True 4100 4100 98.051 1 2359 1 chr2B.!!$R2 2358
5 TraesCS7A01G387500 chr2B 474913540 474915888 2348 True 4071 4071 97.919 6 2359 1 chr2B.!!$R3 2353
6 TraesCS7A01G387500 chr2B 234533217 234535557 2340 True 3973 3973 97.239 7 2357 1 chr2B.!!$R1 2350
7 TraesCS7A01G387500 chr2B 272615323 272616983 1660 False 2734 2734 96.339 1 1665 1 chr2B.!!$F1 1664
8 TraesCS7A01G387500 chr2B 272627161 272627860 699 False 1125 1125 95.597 1656 2359 1 chr2B.!!$F2 703
9 TraesCS7A01G387500 chr1A 278526787 278529143 2356 False 4095 4095 98.008 1 2359 1 chr1A.!!$F1 2358
10 TraesCS7A01G387500 chr3B 201532124 201534482 2358 True 4091 4091 97.966 1 2359 1 chr3B.!!$R1 2358

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
534 537 0.538057 CAAGGAAGAGCACTTGCCCA 60.538 55.0 11.57 0.0 43.8 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1950 1962 3.054065 AGAGATTCATTGTTCCTGACCCC 60.054 47.826 0.0 0.0 0.0 4.95 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 9.928618 TCGATCTCATAGATCCCTATAGAATTT 57.071 33.333 10.52 0.00 46.42 1.82
290 291 8.868916 CAAAATCCGATCCAATTTTTCGTAATT 58.131 29.630 9.04 0.00 33.86 1.40
376 379 4.386867 TCTCTATCGAGCCGTGAAAAAT 57.613 40.909 0.00 0.00 37.19 1.82
429 432 5.752892 TTGGTTTTACGTCAAGCAATACA 57.247 34.783 16.82 0.93 36.85 2.29
465 468 8.607713 TCCCAATATAGGAGTAAAAACAAGACA 58.392 33.333 0.00 0.00 0.00 3.41
533 536 0.538287 ACAAGGAAGAGCACTTGCCC 60.538 55.000 11.57 2.86 46.03 5.36
534 537 0.538057 CAAGGAAGAGCACTTGCCCA 60.538 55.000 11.57 0.00 43.80 5.36
602 605 6.150396 TGGCTTTCAAATTAAGTTCCGAAA 57.850 33.333 2.48 2.48 0.00 3.46
927 930 5.732331 AAGGTTTGATCCTATTCATGGGA 57.268 39.130 0.00 0.00 41.93 4.37
1261 1265 9.483916 GGAGAGAAGAACCTATAATTAGCTTTC 57.516 37.037 0.00 0.00 0.00 2.62
1587 1592 5.356470 GCAAGCTCTTCTATTCTGGTTCATT 59.644 40.000 0.00 0.00 0.00 2.57
1650 1658 4.574421 TCGAGCTTCAAGAAATTGTGAACA 59.426 37.500 0.00 0.00 30.73 3.18
1809 1817 3.612860 CGTTCGACAAATTCCTACCTCTG 59.387 47.826 0.00 0.00 0.00 3.35
1950 1962 7.593273 TGTTCAAATAACAATTAAGGTGAAGCG 59.407 33.333 0.00 0.00 0.00 4.68
2064 2076 8.655651 TGACGTATACAATGCTTGAATTATCA 57.344 30.769 3.32 0.00 0.00 2.15
2170 2182 9.833917 CTAATATGATCATCTCATGGCTATTGT 57.166 33.333 12.53 0.00 44.48 2.71
2174 2186 6.540083 TGATCATCTCATGGCTATTGTGAAT 58.460 36.000 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 2.459060 TCGAATACGGCTTTCCACAA 57.541 45.000 0.0 0.00 40.21 3.33
533 536 5.049405 GGGATGCTTCTAATAACCAACGATG 60.049 44.000 0.0 0.00 0.00 3.84
534 537 5.063880 GGGATGCTTCTAATAACCAACGAT 58.936 41.667 0.0 0.00 0.00 3.73
602 605 3.048600 TCCCTTTGGCAGCATCTACTAT 58.951 45.455 0.0 0.00 0.00 2.12
966 969 3.274288 GCATCCAATCTCCGAAAAGTCT 58.726 45.455 0.0 0.00 0.00 3.24
1419 1423 5.933790 TCGTTAGCACCACATAAAAACATC 58.066 37.500 0.0 0.00 0.00 3.06
1587 1592 6.061022 TGAACCATATAGCCAAGAGAAACA 57.939 37.500 0.0 0.00 0.00 2.83
1623 1631 5.349817 TCACAATTTCTTGAAGCTCGATCTC 59.650 40.000 0.0 0.00 36.20 2.75
1809 1817 5.364157 ACCCAAACACCTCAGAGATAGATAC 59.636 44.000 0.0 0.00 0.00 2.24
1950 1962 3.054065 AGAGATTCATTGTTCCTGACCCC 60.054 47.826 0.0 0.00 0.00 4.95
2064 2076 6.327626 AGAACCCACTATGTAGCATCTACATT 59.672 38.462 20.4 5.39 38.84 2.71
2170 2182 7.949690 AGAACCATCTGATTTGATTCATTCA 57.050 32.000 0.0 0.00 33.59 2.57
2174 2186 9.690913 AGAAATAGAACCATCTGATTTGATTCA 57.309 29.630 0.0 0.00 37.10 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.