Multiple sequence alignment - TraesCS7A01G369200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G369200 chr7A 100.000 4139 0 0 541 4679 542714340 542718478 0.000000e+00 7644.0
1 TraesCS7A01G369200 chr7A 100.000 201 0 0 1 201 542713800 542714000 5.720000e-99 372.0
2 TraesCS7A01G369200 chr1A 98.731 4099 49 3 583 4679 564160199 564156102 0.000000e+00 7278.0
3 TraesCS7A01G369200 chr3A 98.261 4140 69 3 541 4679 144697456 144701593 0.000000e+00 7243.0
4 TraesCS7A01G369200 chr3A 97.449 3606 85 5 1074 4679 126051593 126055191 0.000000e+00 6143.0
5 TraesCS7A01G369200 chr3A 97.884 189 4 0 1 189 144697012 144697200 1.260000e-85 327.0
6 TraesCS7A01G369200 chr3B 95.808 4151 125 12 541 4679 228014572 228018685 0.000000e+00 6656.0
7 TraesCS7A01G369200 chr3B 90.328 2833 196 36 986 3783 7319064 7321853 0.000000e+00 3642.0
8 TraesCS7A01G369200 chr3B 91.076 2667 187 21 969 3618 821214090 821211458 0.000000e+00 3559.0
9 TraesCS7A01G369200 chr3B 88.060 201 21 1 1 201 228014478 228014675 7.830000e-58 235.0
10 TraesCS7A01G369200 chr3B 100.000 33 0 0 1630 1662 412852826 412852858 1.410000e-05 62.1
11 TraesCS7A01G369200 chr4A 95.538 3967 137 14 726 4679 410961461 410957522 0.000000e+00 6309.0
12 TraesCS7A01G369200 chr4A 98.398 2684 43 0 1996 4679 147534744 147532061 0.000000e+00 4719.0
13 TraesCS7A01G369200 chr4A 97.414 1431 23 6 541 1970 147536159 147534742 0.000000e+00 2425.0
14 TraesCS7A01G369200 chr4A 97.512 201 5 0 1 201 147536358 147536158 1.250000e-90 344.0
15 TraesCS7A01G369200 chr7B 96.391 3768 117 10 541 4295 660101540 660105301 0.000000e+00 6187.0
16 TraesCS7A01G369200 chr7B 90.050 201 17 1 1 201 660101446 660101643 1.670000e-64 257.0
17 TraesCS7A01G369200 chr7B 89.394 198 18 1 4 201 36237761 36237567 3.620000e-61 246.0
18 TraesCS7A01G369200 chr6B 96.627 3735 105 12 962 4679 18465676 18469406 0.000000e+00 6180.0
19 TraesCS7A01G369200 chr6B 92.513 187 14 0 15 201 18464180 18463994 7.720000e-68 268.0
20 TraesCS7A01G369200 chr6B 90.860 186 16 1 16 201 18465199 18465383 1.010000e-61 248.0
21 TraesCS7A01G369200 chr6A 97.394 2993 61 10 541 3518 603905480 603908470 0.000000e+00 5079.0
22 TraesCS7A01G369200 chr5D 93.789 3333 171 20 969 4299 34210668 34213966 0.000000e+00 4975.0
23 TraesCS7A01G369200 chr2B 96.987 2622 78 1 2058 4679 311909383 311906763 0.000000e+00 4403.0
24 TraesCS7A01G369200 chr2B 95.247 1536 56 8 541 2063 311925640 311924109 0.000000e+00 2416.0
25 TraesCS7A01G369200 chr2B 92.803 264 19 0 4416 4679 794200556 794200293 2.640000e-102 383.0
26 TraesCS7A01G369200 chr2B 91.444 187 16 0 15 201 311925774 311925588 1.670000e-64 257.0
27 TraesCS7A01G369200 chr2B 100.000 43 0 0 4384 4426 794201145 794201103 3.880000e-11 80.5
28 TraesCS7A01G369200 chr6D 96.144 1634 42 11 542 2161 39065731 39064105 0.000000e+00 2649.0
29 TraesCS7A01G369200 chr4B 95.897 1633 50 8 541 2160 167378481 167376853 0.000000e+00 2628.0
30 TraesCS7A01G369200 chr4B 94.140 1314 57 10 541 1840 273959177 273960484 0.000000e+00 1982.0
31 TraesCS7A01G369200 chr4B 92.513 187 14 0 15 201 167378615 167378429 7.720000e-68 268.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G369200 chr7A 542713800 542718478 4678 False 4008.00 7644 100.000000 1 4679 2 chr7A.!!$F1 4678
1 TraesCS7A01G369200 chr1A 564156102 564160199 4097 True 7278.00 7278 98.731000 583 4679 1 chr1A.!!$R1 4096
2 TraesCS7A01G369200 chr3A 126051593 126055191 3598 False 6143.00 6143 97.449000 1074 4679 1 chr3A.!!$F1 3605
3 TraesCS7A01G369200 chr3A 144697012 144701593 4581 False 3785.00 7243 98.072500 1 4679 2 chr3A.!!$F2 4678
4 TraesCS7A01G369200 chr3B 7319064 7321853 2789 False 3642.00 3642 90.328000 986 3783 1 chr3B.!!$F1 2797
5 TraesCS7A01G369200 chr3B 821211458 821214090 2632 True 3559.00 3559 91.076000 969 3618 1 chr3B.!!$R1 2649
6 TraesCS7A01G369200 chr3B 228014478 228018685 4207 False 3445.50 6656 91.934000 1 4679 2 chr3B.!!$F3 4678
7 TraesCS7A01G369200 chr4A 410957522 410961461 3939 True 6309.00 6309 95.538000 726 4679 1 chr4A.!!$R1 3953
8 TraesCS7A01G369200 chr4A 147532061 147536358 4297 True 2496.00 4719 97.774667 1 4679 3 chr4A.!!$R2 4678
9 TraesCS7A01G369200 chr7B 660101446 660105301 3855 False 3222.00 6187 93.220500 1 4295 2 chr7B.!!$F1 4294
10 TraesCS7A01G369200 chr6B 18465199 18469406 4207 False 3214.00 6180 93.743500 16 4679 2 chr6B.!!$F1 4663
11 TraesCS7A01G369200 chr6A 603905480 603908470 2990 False 5079.00 5079 97.394000 541 3518 1 chr6A.!!$F1 2977
12 TraesCS7A01G369200 chr5D 34210668 34213966 3298 False 4975.00 4975 93.789000 969 4299 1 chr5D.!!$F1 3330
13 TraesCS7A01G369200 chr2B 311906763 311909383 2620 True 4403.00 4403 96.987000 2058 4679 1 chr2B.!!$R1 2621
14 TraesCS7A01G369200 chr2B 311924109 311925774 1665 True 1336.50 2416 93.345500 15 2063 2 chr2B.!!$R2 2048
15 TraesCS7A01G369200 chr2B 794200293 794201145 852 True 231.75 383 96.401500 4384 4679 2 chr2B.!!$R3 295
16 TraesCS7A01G369200 chr6D 39064105 39065731 1626 True 2649.00 2649 96.144000 542 2161 1 chr6D.!!$R1 1619
17 TraesCS7A01G369200 chr4B 273959177 273960484 1307 False 1982.00 1982 94.140000 541 1840 1 chr4B.!!$F1 1299
18 TraesCS7A01G369200 chr4B 167376853 167378615 1762 True 1448.00 2628 94.205000 15 2160 2 chr4B.!!$R1 2145

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
600 846 2.613696 CCATGGTGGGGAGGTGGA 60.614 66.667 2.57 0.0 32.67 4.02 F
1575 1865 1.202510 AGCGAGGATGAGAGCATGTTC 60.203 52.381 0.50 0.5 34.11 3.18 F
2393 2686 1.685224 CAGGTTCAAGGGGCAGCTA 59.315 57.895 0.00 0.0 0.00 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2070 2362 0.807496 AGCTTCTTTCGCAATGCCTC 59.193 50.000 0.00 0.0 0.00 4.70 R
2653 2946 1.269448 CCCAAAGGTGGTCATCAAACG 59.731 52.381 0.00 0.0 44.30 3.60 R
4258 4570 2.881734 AGCTAAGCCTCCTTTTGCTTT 58.118 42.857 1.75 0.0 45.09 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 4.776322 CGGCGGCACATGGAGGAA 62.776 66.667 10.53 0.00 0.00 3.36
578 824 2.664851 CTGCTGACGACGGGCAAA 60.665 61.111 12.00 0.00 35.49 3.68
581 827 2.664851 CTGACGACGGGCAAAGCA 60.665 61.111 0.00 0.00 0.00 3.91
597 843 3.341629 CAGCCATGGTGGGGAGGT 61.342 66.667 14.67 0.00 38.19 3.85
600 846 2.613696 CCATGGTGGGGAGGTGGA 60.614 66.667 2.57 0.00 32.67 4.02
1046 1293 4.378046 GCTGAAAATCAATTTGCTTGGCAG 60.378 41.667 9.31 9.31 40.61 4.85
1575 1865 1.202510 AGCGAGGATGAGAGCATGTTC 60.203 52.381 0.50 0.50 34.11 3.18
2070 2362 2.102252 GAGGATGCAACTCTAGGACCAG 59.898 54.545 12.94 0.00 32.28 4.00
2173 2466 7.072454 AGCCTTGAAGGAACTATATGGTGATTA 59.928 37.037 16.93 0.00 38.49 1.75
2393 2686 1.685224 CAGGTTCAAGGGGCAGCTA 59.315 57.895 0.00 0.00 0.00 3.32
2653 2946 5.010012 TCAAGAAGAAGTTTCATGGAAAGGC 59.990 40.000 0.00 0.00 31.87 4.35
3951 4263 6.464607 GGGAAAGGGAGTAAATCTGGATCTAC 60.465 46.154 0.00 0.00 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
562 808 2.664851 CTTTGCCCGTCGTCAGCA 60.665 61.111 0.00 0.0 33.97 4.41
564 810 2.664851 TGCTTTGCCCGTCGTCAG 60.665 61.111 0.00 0.0 0.00 3.51
565 811 2.664851 CTGCTTTGCCCGTCGTCA 60.665 61.111 0.00 0.0 0.00 4.35
578 824 3.736224 CTCCCCACCATGGCTGCT 61.736 66.667 13.04 0.0 35.79 4.24
581 827 3.341629 CACCTCCCCACCATGGCT 61.342 66.667 13.04 0.0 35.79 4.75
1575 1865 4.399618 TCATCTTCCTCTACTTCAACCTCG 59.600 45.833 0.00 0.0 0.00 4.63
1743 2034 1.139256 TGTGGTGCACTCTTTTCGGTA 59.861 47.619 17.98 0.0 35.11 4.02
1829 2120 4.558226 ACTGTGCACTCATCTTCCATTA 57.442 40.909 19.41 0.0 0.00 1.90
2070 2362 0.807496 AGCTTCTTTCGCAATGCCTC 59.193 50.000 0.00 0.0 0.00 4.70
2407 2700 2.036958 CCAACTATGGCCATCAACGA 57.963 50.000 24.80 2.6 40.58 3.85
2653 2946 1.269448 CCCAAAGGTGGTCATCAAACG 59.731 52.381 0.00 0.0 44.30 3.60
3951 4263 5.944007 ACCATAGGTTACCTTTTTGCTACTG 59.056 40.000 10.01 0.0 34.61 2.74
4258 4570 2.881734 AGCTAAGCCTCCTTTTGCTTT 58.118 42.857 1.75 0.0 45.09 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.