Multiple sequence alignment - TraesCS7A01G338000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G338000 chr7A 100.000 2897 0 0 1 2897 494490275 494493171 0 5350
1 TraesCS7A01G338000 chr7A 99.483 2899 13 1 1 2897 494454434 494457332 0 5269
2 TraesCS7A01G338000 chr7A 89.616 2812 244 37 1 2796 522956878 522959657 0 3531
3 TraesCS7A01G338000 chr1A 95.613 2918 102 16 1 2897 335664406 335667318 0 4656
4 TraesCS7A01G338000 chr3A 94.157 2824 151 12 75 2891 259063018 259065834 0 4289
5 TraesCS7A01G338000 chr4A 90.007 2922 239 37 8 2885 113197685 113200597 0 3729
6 TraesCS7A01G338000 chr6A 89.508 2926 248 43 8 2885 481860336 481857422 0 3648
7 TraesCS7A01G338000 chr6A 84.414 2868 375 57 75 2897 509868428 509871268 0 2754
8 TraesCS7A01G338000 chr6A 87.953 938 78 21 1979 2897 335915489 335916410 0 1074
9 TraesCS7A01G338000 chr5D 88.383 2746 276 28 1 2718 252500642 252497912 0 3264
10 TraesCS7A01G338000 chr5D 86.632 2910 332 44 8 2886 179127147 179130030 0 3166
11 TraesCS7A01G338000 chr2D 87.277 2853 315 38 73 2897 290211543 290208711 0 3214
12 TraesCS7A01G338000 chr2A 87.594 1193 106 13 1710 2886 187020270 187021436 0 1345


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G338000 chr7A 494490275 494493171 2896 False 5350 5350 100.000 1 2897 1 chr7A.!!$F2 2896
1 TraesCS7A01G338000 chr7A 494454434 494457332 2898 False 5269 5269 99.483 1 2897 1 chr7A.!!$F1 2896
2 TraesCS7A01G338000 chr7A 522956878 522959657 2779 False 3531 3531 89.616 1 2796 1 chr7A.!!$F3 2795
3 TraesCS7A01G338000 chr1A 335664406 335667318 2912 False 4656 4656 95.613 1 2897 1 chr1A.!!$F1 2896
4 TraesCS7A01G338000 chr3A 259063018 259065834 2816 False 4289 4289 94.157 75 2891 1 chr3A.!!$F1 2816
5 TraesCS7A01G338000 chr4A 113197685 113200597 2912 False 3729 3729 90.007 8 2885 1 chr4A.!!$F1 2877
6 TraesCS7A01G338000 chr6A 481857422 481860336 2914 True 3648 3648 89.508 8 2885 1 chr6A.!!$R1 2877
7 TraesCS7A01G338000 chr6A 509868428 509871268 2840 False 2754 2754 84.414 75 2897 1 chr6A.!!$F2 2822
8 TraesCS7A01G338000 chr6A 335915489 335916410 921 False 1074 1074 87.953 1979 2897 1 chr6A.!!$F1 918
9 TraesCS7A01G338000 chr5D 252497912 252500642 2730 True 3264 3264 88.383 1 2718 1 chr5D.!!$R1 2717
10 TraesCS7A01G338000 chr5D 179127147 179130030 2883 False 3166 3166 86.632 8 2886 1 chr5D.!!$F1 2878
11 TraesCS7A01G338000 chr2D 290208711 290211543 2832 True 3214 3214 87.277 73 2897 1 chr2D.!!$R1 2824
12 TraesCS7A01G338000 chr2A 187020270 187021436 1166 False 1345 1345 87.594 1710 2886 1 chr2A.!!$F1 1176

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
986 1027 2.231478 GAGGATTGACTTCGGACACTCA 59.769 50.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2271 2344 7.896811 TCTAGGTGTATCATAGTAAATGCAGG 58.103 38.462 0.0 0.0 32.92 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 152 4.391830 GCATCCGTCTCTCAAAATTGTGTA 59.608 41.667 0.0 0.0 0.00 2.90
986 1027 2.231478 GAGGATTGACTTCGGACACTCA 59.769 50.000 0.0 0.0 0.00 3.41
1200 1241 3.744238 TCTCCGTGTGACAAGATTGAA 57.256 42.857 0.0 0.0 0.00 2.69
2271 2344 8.295569 AGTACACTAGAAAACTTCGTCATTTC 57.704 34.615 0.0 0.0 34.14 2.17
2425 2499 3.244033 CAGACATGGAGAAGTGAGGAC 57.756 52.381 0.0 0.0 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 37 0.402121 AAGCAAGGGGAGGTTCAGAC 59.598 55.000 0.00 0.0 0.00 3.51
125 152 4.589374 ACTATGCTCGGCTAAATCTAGGTT 59.411 41.667 0.00 0.0 0.00 3.50
986 1027 3.318017 GCTGCCATATCGACGTAAGATT 58.682 45.455 10.68 0.0 43.62 2.40
1200 1241 9.192642 TCATCATCAAACATAATCCATGAAAGT 57.807 29.630 0.00 0.0 38.10 2.66
2271 2344 7.896811 TCTAGGTGTATCATAGTAAATGCAGG 58.103 38.462 0.00 0.0 32.92 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.