Multiple sequence alignment - TraesCS7A01G294100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G294100 chr7A 100.000 2384 0 0 1 2384 378456061 378458444 0.000000e+00 4403.0
1 TraesCS7A01G294100 chr6A 95.119 2397 104 4 1 2384 328989371 328991767 0.000000e+00 3766.0
2 TraesCS7A01G294100 chr6A 94.386 1817 76 6 1 1805 328975413 328977215 0.000000e+00 2767.0
3 TraesCS7A01G294100 chr6A 89.394 924 68 18 9 910 252796441 252795526 0.000000e+00 1136.0
4 TraesCS7A01G294100 chr6A 97.909 574 11 1 1792 2365 328982926 328983498 0.000000e+00 992.0
5 TraesCS7A01G294100 chr6A 86.264 728 71 22 1674 2384 240068505 240067790 0.000000e+00 763.0
6 TraesCS7A01G294100 chr6A 86.676 698 69 22 1674 2360 240076734 240076050 0.000000e+00 752.0
7 TraesCS7A01G294100 chr6A 92.821 195 11 3 1511 1703 273121208 273121015 1.800000e-71 279.0
8 TraesCS7A01G294100 chr6A 92.105 190 13 2 1515 1703 273129227 273129039 1.400000e-67 267.0
9 TraesCS7A01G294100 chr6A 95.122 123 5 1 1572 1694 144635053 144635174 2.420000e-45 193.0
10 TraesCS7A01G294100 chr6A 95.122 123 5 1 1572 1694 144643011 144643132 2.420000e-45 193.0
11 TraesCS7A01G294100 chr6A 86.517 89 6 2 1594 1682 55643419 55643337 2.520000e-15 93.5
12 TraesCS7A01G294100 chr6A 95.238 42 0 1 1620 1661 506119446 506119407 5.500000e-07 65.8
13 TraesCS7A01G294100 chr6A 95.238 42 0 1 1620 1661 506127351 506127312 5.500000e-07 65.8
14 TraesCS7A01G294100 chr2A 91.437 1016 60 11 544 1546 654611196 654612197 0.000000e+00 1369.0
15 TraesCS7A01G294100 chr2A 93.927 708 39 4 842 1546 654603413 654604119 0.000000e+00 1066.0
16 TraesCS7A01G294100 chr2A 91.602 774 50 7 622 1382 300946909 300947680 0.000000e+00 1055.0
17 TraesCS7A01G294100 chr2A 91.276 768 52 7 628 1382 301198832 301199597 0.000000e+00 1033.0
18 TraesCS7A01G294100 chr2A 90.052 774 62 7 622 1382 300954856 300955627 0.000000e+00 989.0
19 TraesCS7A01G294100 chr2A 90.723 733 63 4 4 732 581535003 581535734 0.000000e+00 972.0
20 TraesCS7A01G294100 chr2A 85.420 727 78 21 1674 2384 252672021 252671307 0.000000e+00 730.0
21 TraesCS7A01G294100 chr2A 94.643 112 6 0 731 842 387675713 387675824 8.760000e-40 174.0
22 TraesCS7A01G294100 chr2A 82.778 180 16 8 2214 2384 442768133 442768306 1.910000e-31 147.0
23 TraesCS7A01G294100 chr2A 82.778 180 16 8 2214 2384 442811653 442811826 1.910000e-31 147.0
24 TraesCS7A01G294100 chr2A 80.465 215 21 14 2181 2382 251307587 251307793 6.870000e-31 145.0
25 TraesCS7A01G294100 chr2A 78.355 231 26 17 2167 2382 251316025 251316246 6.920000e-26 128.0
26 TraesCS7A01G294100 chr2A 95.455 66 2 1 8 73 480041620 480041556 1.170000e-18 104.0
27 TraesCS7A01G294100 chr3A 91.080 1009 76 6 547 1543 667920689 667919683 0.000000e+00 1352.0
28 TraesCS7A01G294100 chr3A 90.594 1010 69 10 547 1543 667908792 667907796 0.000000e+00 1315.0
29 TraesCS7A01G294100 chr3A 90.470 745 63 6 1 739 243924845 243924103 0.000000e+00 976.0
30 TraesCS7A01G294100 chr3A 90.599 734 65 3 2 732 22052594 22053326 0.000000e+00 970.0
31 TraesCS7A01G294100 chr3A 90.612 735 63 5 2 732 22103209 22103941 0.000000e+00 970.0
32 TraesCS7A01G294100 chr3A 89.853 749 60 6 1 745 243917056 243916320 0.000000e+00 948.0
33 TraesCS7A01G294100 chr3A 89.637 193 14 6 1515 1703 371175681 371175871 8.520000e-60 241.0
34 TraesCS7A01G294100 chr3A 89.119 193 15 6 1515 1703 371167525 371167715 3.960000e-58 235.0
35 TraesCS7A01G294100 chr3A 88.601 193 16 6 1515 1703 734275967 734276157 1.840000e-56 230.0
36 TraesCS7A01G294100 chr3A 87.755 196 17 4 1282 1470 328781712 328781517 3.080000e-54 222.0
37 TraesCS7A01G294100 chr3A 87.500 192 18 6 1515 1703 371177883 371178071 1.430000e-52 217.0
38 TraesCS7A01G294100 chr5A 90.970 742 63 3 1 739 168463950 168464690 0.000000e+00 996.0
39 TraesCS7A01G294100 chr5A 90.621 725 64 4 1 722 168518844 168519567 0.000000e+00 959.0
40 TraesCS7A01G294100 chr5A 87.988 666 61 17 1674 2332 438836469 438837122 0.000000e+00 769.0
41 TraesCS7A01G294100 chr5A 86.245 727 73 20 1674 2384 438828496 438829211 0.000000e+00 763.0
42 TraesCS7A01G294100 chr5A 89.496 238 10 4 693 917 640837197 640836962 1.080000e-73 287.0
43 TraesCS7A01G294100 chr5A 92.920 113 8 0 730 842 287615883 287615771 5.270000e-37 165.0
44 TraesCS7A01G294100 chr5A 91.150 113 10 0 730 842 307312437 307312325 1.140000e-33 154.0
45 TraesCS7A01G294100 chr1A 88.567 691 59 13 1687 2364 24206867 24207550 0.000000e+00 821.0
46 TraesCS7A01G294100 chr4A 86.264 728 70 23 1674 2384 108243588 108244302 0.000000e+00 763.0
47 TraesCS7A01G294100 chr4A 85.796 697 74 19 1703 2384 108260641 108261327 0.000000e+00 715.0
48 TraesCS7A01G294100 chr4A 86.486 222 20 5 1257 1470 297882205 297882424 3.960000e-58 235.0
49 TraesCS7A01G294100 chr4A 86.857 175 21 1 668 842 137558255 137558083 6.720000e-46 195.0
50 TraesCS7A01G294100 chr4A 89.404 151 15 1 692 842 137550117 137549968 3.130000e-44 189.0
51 TraesCS7A01G294100 chr4A 90.265 113 11 0 730 842 236053196 236053308 5.310000e-32 148.0
52 TraesCS7A01G294100 chr4A 93.750 64 3 1 1409 1471 296542495 296542432 7.020000e-16 95.3
53 TraesCS7A01G294100 chr4A 93.651 63 3 1 1410 1471 296711828 296711890 2.520000e-15 93.5
54 TraesCS7A01G294100 chr4A 93.443 61 2 2 1416 1474 331618342 331618402 3.260000e-14 89.8
55 TraesCS7A01G294100 chr4A 91.803 61 3 2 1416 1474 331626225 331626285 1.520000e-12 84.2
56 TraesCS7A01G294100 chr4B 95.000 40 0 1 1622 1661 123112940 123112977 7.120000e-06 62.1
57 TraesCS7A01G294100 chr4B 92.857 42 1 1 1620 1661 123120798 123120837 2.560000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G294100 chr7A 378456061 378458444 2383 False 4403 4403 100.0000 1 2384 1 chr7A.!!$F1 2383
1 TraesCS7A01G294100 chr6A 328989371 328991767 2396 False 3766 3766 95.1190 1 2384 1 chr6A.!!$F5 2383
2 TraesCS7A01G294100 chr6A 328975413 328977215 1802 False 2767 2767 94.3860 1 1805 1 chr6A.!!$F3 1804
3 TraesCS7A01G294100 chr6A 252795526 252796441 915 True 1136 1136 89.3940 9 910 1 chr6A.!!$R4 901
4 TraesCS7A01G294100 chr6A 328982926 328983498 572 False 992 992 97.9090 1792 2365 1 chr6A.!!$F4 573
5 TraesCS7A01G294100 chr6A 240067790 240068505 715 True 763 763 86.2640 1674 2384 1 chr6A.!!$R2 710
6 TraesCS7A01G294100 chr6A 240076050 240076734 684 True 752 752 86.6760 1674 2360 1 chr6A.!!$R3 686
7 TraesCS7A01G294100 chr2A 654611196 654612197 1001 False 1369 1369 91.4370 544 1546 1 chr2A.!!$F11 1002
8 TraesCS7A01G294100 chr2A 654603413 654604119 706 False 1066 1066 93.9270 842 1546 1 chr2A.!!$F10 704
9 TraesCS7A01G294100 chr2A 300946909 300947680 771 False 1055 1055 91.6020 622 1382 1 chr2A.!!$F3 760
10 TraesCS7A01G294100 chr2A 301198832 301199597 765 False 1033 1033 91.2760 628 1382 1 chr2A.!!$F5 754
11 TraesCS7A01G294100 chr2A 300954856 300955627 771 False 989 989 90.0520 622 1382 1 chr2A.!!$F4 760
12 TraesCS7A01G294100 chr2A 581535003 581535734 731 False 972 972 90.7230 4 732 1 chr2A.!!$F9 728
13 TraesCS7A01G294100 chr2A 252671307 252672021 714 True 730 730 85.4200 1674 2384 1 chr2A.!!$R1 710
14 TraesCS7A01G294100 chr3A 667919683 667920689 1006 True 1352 1352 91.0800 547 1543 1 chr3A.!!$R5 996
15 TraesCS7A01G294100 chr3A 667907796 667908792 996 True 1315 1315 90.5940 547 1543 1 chr3A.!!$R4 996
16 TraesCS7A01G294100 chr3A 243924103 243924845 742 True 976 976 90.4700 1 739 1 chr3A.!!$R2 738
17 TraesCS7A01G294100 chr3A 22052594 22053326 732 False 970 970 90.5990 2 732 1 chr3A.!!$F1 730
18 TraesCS7A01G294100 chr3A 22103209 22103941 732 False 970 970 90.6120 2 732 1 chr3A.!!$F2 730
19 TraesCS7A01G294100 chr3A 243916320 243917056 736 True 948 948 89.8530 1 745 1 chr3A.!!$R1 744
20 TraesCS7A01G294100 chr3A 371175681 371178071 2390 False 229 241 88.5685 1515 1703 2 chr3A.!!$F5 188
21 TraesCS7A01G294100 chr5A 168463950 168464690 740 False 996 996 90.9700 1 739 1 chr5A.!!$F1 738
22 TraesCS7A01G294100 chr5A 168518844 168519567 723 False 959 959 90.6210 1 722 1 chr5A.!!$F2 721
23 TraesCS7A01G294100 chr5A 438836469 438837122 653 False 769 769 87.9880 1674 2332 1 chr5A.!!$F4 658
24 TraesCS7A01G294100 chr5A 438828496 438829211 715 False 763 763 86.2450 1674 2384 1 chr5A.!!$F3 710
25 TraesCS7A01G294100 chr1A 24206867 24207550 683 False 821 821 88.5670 1687 2364 1 chr1A.!!$F1 677
26 TraesCS7A01G294100 chr4A 108243588 108244302 714 False 763 763 86.2640 1674 2384 1 chr4A.!!$F1 710
27 TraesCS7A01G294100 chr4A 108260641 108261327 686 False 715 715 85.7960 1703 2384 1 chr4A.!!$F2 681

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
707 724 0.034337 GTGGGTAGACGAACTTGGCA 59.966 55.0 0.0 0.0 0.0 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1604 1637 1.22706 CTCGCACGCATCTGGATCA 60.227 57.895 0.0 0.0 0.0 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
175 181 0.165944 CGGTTCCGACAACTCATTGC 59.834 55.000 5.19 0.00 39.66 3.56
229 235 1.337118 GCAAAAGATGGTGGGGTGAA 58.663 50.000 0.00 0.00 0.00 3.18
278 284 1.673920 GACGGTGACAAGGCAAAAGAA 59.326 47.619 0.00 0.00 0.00 2.52
285 291 1.836802 ACAAGGCAAAAGAAGGGCAAA 59.163 42.857 0.00 0.00 0.00 3.68
351 357 3.441222 ACATCACACATGCATTCGTTCAT 59.559 39.130 0.00 0.00 0.00 2.57
427 438 1.046472 TCGATGCGGTGTAGGGGAAT 61.046 55.000 0.00 0.00 0.00 3.01
444 455 0.899720 AATTAGGCGTTCTCGGGACA 59.100 50.000 0.00 0.00 37.56 4.02
581 597 2.829120 TCATCGGTGTCATGGTACTTGA 59.171 45.455 0.00 0.00 0.00 3.02
611 627 3.109592 TTGCCGGTCCCGTTCTTGT 62.110 57.895 1.90 0.00 37.81 3.16
639 655 0.248417 TCGTTCACGTTCGTTCGGAA 60.248 50.000 0.00 0.00 40.80 4.30
680 697 4.720902 TCGGGGCGACGGTAGTGA 62.721 66.667 0.00 0.00 0.00 3.41
707 724 0.034337 GTGGGTAGACGAACTTGGCA 59.966 55.000 0.00 0.00 0.00 4.92
728 745 3.382832 CCGAGGGCTCCAGACGTT 61.383 66.667 0.00 0.00 0.00 3.99
765 782 3.201487 TCCGGGTCTTGAGACATACTAGA 59.799 47.826 12.76 0.00 46.47 2.43
926 952 1.134699 GCAGGCTACAGCACACATCTA 60.135 52.381 3.24 0.00 44.36 1.98
1024 1051 2.217038 TGCGAAGGAGAAGCAGGGT 61.217 57.895 0.00 0.00 35.81 4.34
1231 1258 1.666011 GTGAGAGGCGAAGTGGACA 59.334 57.895 0.00 0.00 0.00 4.02
1604 1637 1.780309 AGAGAGATCGAGGGAGATGGT 59.220 52.381 0.00 0.00 0.00 3.55
1790 1827 3.428316 GCTGGACTCCTTCTCTCTTAACG 60.428 52.174 0.00 0.00 0.00 3.18
1902 1951 1.654220 GAGCGCTGGAACTTTGCAA 59.346 52.632 18.48 0.00 0.00 4.08
1924 1973 9.784531 TGCAAAAATAGAATAAAATGGTTTGGA 57.215 25.926 0.00 0.00 0.00 3.53
1989 2039 4.803088 TCAAACTTGAGCCATTTTTGAACG 59.197 37.500 0.00 0.00 34.16 3.95
2124 2180 2.843401 TGGGTCGATTCGAAGGAAAA 57.157 45.000 10.87 0.00 37.72 2.29
2374 2460 3.194755 ACATGATGCAAAGCACATGATGT 59.805 39.130 26.04 15.64 44.23 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
175 181 2.032030 ACTTTCTTTTGCACCGATGTCG 60.032 45.455 0.00 0.0 39.44 4.35
278 284 2.594592 GTCGGTGCACTTTGCCCT 60.595 61.111 17.98 0.0 44.23 5.19
427 438 0.899720 AATGTCCCGAGAACGCCTAA 59.100 50.000 0.00 0.0 38.29 2.69
444 455 6.530534 CGAGAACGACTAATTCCACTACAAAT 59.469 38.462 0.00 0.0 42.66 2.32
611 627 2.666344 CGAACGTGAACGACTACCATCA 60.666 50.000 10.26 0.0 43.02 3.07
639 655 3.323979 ACGTTGGAGTCATCAAGTACCTT 59.676 43.478 0.00 0.0 0.00 3.50
680 697 1.825090 TCGTCTACCCACGTGTGTAT 58.175 50.000 15.65 0.0 40.79 2.29
689 706 0.320374 CTGCCAAGTTCGTCTACCCA 59.680 55.000 0.00 0.0 0.00 4.51
707 724 1.456705 GTCTGGAGCCCTCGGATCT 60.457 63.158 0.00 0.0 38.31 2.75
728 745 0.528924 CCGGATCGACAAGTACCACA 59.471 55.000 0.00 0.0 0.00 4.17
765 782 1.541310 TTCCTCGAAGGCACCGATGT 61.541 55.000 1.94 0.0 34.61 3.06
926 952 3.083997 GACCTCTCCGTGGGCCAT 61.084 66.667 10.70 0.0 0.00 4.40
1003 1030 1.080501 CTGCTTCTCCTTCGCACGA 60.081 57.895 0.00 0.0 0.00 4.35
1250 1278 1.381851 CCCTCCTCTGCTTTGCCTT 59.618 57.895 0.00 0.0 0.00 4.35
1579 1612 4.177537 TCTCCCTCGATCTCTCTTTCAT 57.822 45.455 0.00 0.0 0.00 2.57
1604 1637 1.227060 CTCGCACGCATCTGGATCA 60.227 57.895 0.00 0.0 0.00 2.92
1790 1827 7.201741 CGGAGGGAATTAAGAAAAGAAAGATCC 60.202 40.741 0.00 0.0 0.00 3.36
1989 2039 1.946081 CATTTGGGTTTGGTTGGTTGC 59.054 47.619 0.00 0.0 0.00 4.17
2124 2180 4.015872 TCGAAACCCAATCACTAGCTTT 57.984 40.909 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.