Multiple sequence alignment - TraesCS7A01G288000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G288000 chr7A 100.000 2861 0 0 1 2861 345260686 345263546 0 5284
1 TraesCS7A01G288000 chr7A 96.211 607 21 2 1 606 7959798 7960403 0 992
2 TraesCS7A01G288000 chr7A 96.211 607 21 2 1 606 8099720 8100325 0 992
3 TraesCS7A01G288000 chr7A 96.046 607 22 2 1 606 577266897 577266292 0 987
4 TraesCS7A01G288000 chr2B 98.715 2257 29 0 605 2861 571946213 571948469 0 4008
5 TraesCS7A01G288000 chr3A 98.504 2272 29 3 594 2860 457924723 457926994 0 4002
6 TraesCS7A01G288000 chr3A 97.419 2286 34 7 598 2861 11577125 11579407 0 3871
7 TraesCS7A01G288000 chr3A 95.717 607 24 2 1 606 633346498 633345893 0 976
8 TraesCS7A01G288000 chr3A 95.717 607 24 2 1 606 662696196 662696801 0 976
9 TraesCS7A01G288000 chr1B 98.714 2255 27 2 607 2861 322392626 322394878 0 4002
10 TraesCS7A01G288000 chr6B 98.795 2157 26 0 607 2763 568189369 568191525 0 3840
11 TraesCS7A01G288000 chr1A 97.518 2176 33 2 638 2813 113882216 113884370 0 3699
12 TraesCS7A01G288000 chr3B 95.139 2263 82 14 616 2858 139621351 139623605 0 3544
13 TraesCS7A01G288000 chr4A 97.592 2076 31 1 805 2861 705572674 705570599 0 3539
14 TraesCS7A01G288000 chr4A 95.717 607 24 2 1 606 112438202 112437597 0 976
15 TraesCS7A01G288000 chr4B 98.035 1527 19 7 606 2129 134586679 134585161 0 2643
16 TraesCS7A01G288000 chr4B 98.686 761 10 0 2101 2861 134585244 134584484 0 1351
17 TraesCS7A01G288000 chr6A 96.540 607 18 2 1 606 76472380 76472984 0 1002
18 TraesCS7A01G288000 chr5A 95.717 607 24 2 1 606 520875468 520874863 0 976
19 TraesCS7A01G288000 chr2A 95.717 607 24 2 1 606 86748680 86749285 0 976


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G288000 chr7A 345260686 345263546 2860 False 5284 5284 100.0000 1 2861 1 chr7A.!!$F3 2860
1 TraesCS7A01G288000 chr7A 7959798 7960403 605 False 992 992 96.2110 1 606 1 chr7A.!!$F1 605
2 TraesCS7A01G288000 chr7A 8099720 8100325 605 False 992 992 96.2110 1 606 1 chr7A.!!$F2 605
3 TraesCS7A01G288000 chr7A 577266292 577266897 605 True 987 987 96.0460 1 606 1 chr7A.!!$R1 605
4 TraesCS7A01G288000 chr2B 571946213 571948469 2256 False 4008 4008 98.7150 605 2861 1 chr2B.!!$F1 2256
5 TraesCS7A01G288000 chr3A 457924723 457926994 2271 False 4002 4002 98.5040 594 2860 1 chr3A.!!$F2 2266
6 TraesCS7A01G288000 chr3A 11577125 11579407 2282 False 3871 3871 97.4190 598 2861 1 chr3A.!!$F1 2263
7 TraesCS7A01G288000 chr3A 633345893 633346498 605 True 976 976 95.7170 1 606 1 chr3A.!!$R1 605
8 TraesCS7A01G288000 chr3A 662696196 662696801 605 False 976 976 95.7170 1 606 1 chr3A.!!$F3 605
9 TraesCS7A01G288000 chr1B 322392626 322394878 2252 False 4002 4002 98.7140 607 2861 1 chr1B.!!$F1 2254
10 TraesCS7A01G288000 chr6B 568189369 568191525 2156 False 3840 3840 98.7950 607 2763 1 chr6B.!!$F1 2156
11 TraesCS7A01G288000 chr1A 113882216 113884370 2154 False 3699 3699 97.5180 638 2813 1 chr1A.!!$F1 2175
12 TraesCS7A01G288000 chr3B 139621351 139623605 2254 False 3544 3544 95.1390 616 2858 1 chr3B.!!$F1 2242
13 TraesCS7A01G288000 chr4A 705570599 705572674 2075 True 3539 3539 97.5920 805 2861 1 chr4A.!!$R2 2056
14 TraesCS7A01G288000 chr4A 112437597 112438202 605 True 976 976 95.7170 1 606 1 chr4A.!!$R1 605
15 TraesCS7A01G288000 chr4B 134584484 134586679 2195 True 1997 2643 98.3605 606 2861 2 chr4B.!!$R1 2255
16 TraesCS7A01G288000 chr6A 76472380 76472984 604 False 1002 1002 96.5400 1 606 1 chr6A.!!$F1 605
17 TraesCS7A01G288000 chr5A 520874863 520875468 605 True 976 976 95.7170 1 606 1 chr5A.!!$R1 605
18 TraesCS7A01G288000 chr2A 86748680 86749285 605 False 976 976 95.7170 1 606 1 chr2A.!!$F1 605

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
451 454 2.221055 CGTGAGCGCTAAAGTTTCTGTT 59.779 45.455 11.5 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2420 2511 2.813754 GCAATCTGGTGTTCAAGTGCTA 59.186 45.455 0.0 0.0 30.69 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 135 6.031471 GCGAAAGAAAACAAAAGACCACTTA 58.969 36.000 0.00 0.00 35.05 2.24
265 268 4.314121 AGCAAACAACACACACAAAACAT 58.686 34.783 0.00 0.00 0.00 2.71
370 373 9.489084 TTCTGGACGTGAGGAATTTATATATTG 57.511 33.333 0.00 0.00 0.00 1.90
451 454 2.221055 CGTGAGCGCTAAAGTTTCTGTT 59.779 45.455 11.50 0.00 0.00 3.16
530 535 7.268586 TGGCACAAACACTAATTAAACACAAT 58.731 30.769 0.00 0.00 31.92 2.71
736 742 2.319136 TACAAAACAGCTGTGGACGT 57.681 45.000 22.49 17.07 0.00 4.34
922 931 3.394836 GCCAGCCGTCTCCTCCTT 61.395 66.667 0.00 0.00 0.00 3.36
923 932 2.896443 CCAGCCGTCTCCTCCTTC 59.104 66.667 0.00 0.00 0.00 3.46
1129 1138 1.080093 GCCGACATGACGAAGGACA 60.080 57.895 19.00 0.00 35.09 4.02
1267 1276 1.406898 CTGATGAGTGCGAGCTTCCTA 59.593 52.381 0.00 0.00 0.00 2.94
1692 1705 6.183360 TGGCTCTTCAGAAATTTGTGTTTGAT 60.183 34.615 14.36 0.00 0.00 2.57
2285 2370 1.694169 GGGCCCAGGGATCTTCAGA 60.694 63.158 19.95 0.00 0.00 3.27
2679 2775 3.208747 TGTTCAACCTTCACCTCTTCC 57.791 47.619 0.00 0.00 0.00 3.46
2816 2912 4.487714 TGACAACAGTCTCTTTCAGGTT 57.512 40.909 0.00 0.00 33.41 3.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 238 6.639671 TGTGTGTGTTGTTTGCTTATTTTC 57.360 33.333 0.00 0.00 0.00 2.29
530 535 4.020543 AGCCTCTGTTTTGGTTGTGTTTA 58.979 39.130 0.00 0.00 0.00 2.01
673 679 0.404426 GGAGGGCTAGTTTTGTGGGT 59.596 55.000 0.00 0.00 0.00 4.51
1267 1276 5.818857 GGCCATCAAATCAAATGTTAGCATT 59.181 36.000 0.00 0.00 46.38 3.56
1692 1705 5.766670 CAGCCTCATAATTTCAGCATCCTTA 59.233 40.000 0.00 0.00 0.00 2.69
2285 2370 5.890985 TGCCAAATATGCCAAGTTGTACTAT 59.109 36.000 1.45 0.00 0.00 2.12
2420 2511 2.813754 GCAATCTGGTGTTCAAGTGCTA 59.186 45.455 0.00 0.00 30.69 3.49
2679 2775 4.838486 GACGTCGAGCTCCTGCCG 62.838 72.222 8.47 7.72 40.80 5.69
2712 2808 1.027357 GCAGAAACATGCCCATCGAT 58.973 50.000 0.00 0.00 40.43 3.59
2816 2912 1.303799 GGTCTACGCCTCTGACGACA 61.304 60.000 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.