Multiple sequence alignment - TraesCS7A01G285900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G285900 chr7A 100.000 2549 0 0 1 2549 332475525 332472977 0 4708
1 TraesCS7A01G285900 chr7A 96.853 572 16 2 1 572 310568518 310569087 0 955
2 TraesCS7A01G285900 chr7A 96.510 573 19 1 1 572 310397847 310398419 0 946
3 TraesCS7A01G285900 chr7A 95.993 574 21 2 1 572 506700354 506699781 0 931
4 TraesCS7A01G285900 chr2B 99.192 1979 16 0 571 2549 776222960 776224938 0 3567
5 TraesCS7A01G285900 chr2B 99.091 1980 18 0 570 2549 781094238 781096217 0 3557
6 TraesCS7A01G285900 chr3B 99.141 1979 16 1 571 2549 702857656 702855679 0 3559
7 TraesCS7A01G285900 chr3B 99.090 1978 18 0 572 2549 20305087 20307064 0 3554
8 TraesCS7A01G285900 chr7B 99.092 1982 15 2 568 2549 202776911 202778889 0 3557
9 TraesCS7A01G285900 chr3A 98.993 1986 18 2 565 2549 54951909 54953893 0 3555
10 TraesCS7A01G285900 chr5B 99.090 1979 17 1 572 2549 641128780 641126802 0 3554
11 TraesCS7A01G285900 chr4B 99.041 1981 17 2 570 2549 368430370 368428391 0 3552
12 TraesCS7A01G285900 chr6A 98.991 1983 18 2 568 2549 616131291 616133272 0 3550
13 TraesCS7A01G285900 chr6A 96.154 572 21 1 1 572 92076525 92075955 0 933
14 TraesCS7A01G285900 chr6A 95.979 572 23 0 1 572 396115224 396114653 0 929
15 TraesCS7A01G285900 chr2A 96.503 572 19 1 1 572 190592385 190591815 0 944
16 TraesCS7A01G285900 chr1A 96.154 572 21 1 1 572 211041410 211041980 0 933
17 TraesCS7A01G285900 chr5A 95.986 573 22 1 1 572 79725732 79726304 0 929
18 TraesCS7A01G285900 chr5A 95.986 573 21 2 1 572 618909583 618909012 0 929


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G285900 chr7A 332472977 332475525 2548 True 4708 4708 100.000 1 2549 1 chr7A.!!$R1 2548
1 TraesCS7A01G285900 chr7A 310568518 310569087 569 False 955 955 96.853 1 572 1 chr7A.!!$F2 571
2 TraesCS7A01G285900 chr7A 310397847 310398419 572 False 946 946 96.510 1 572 1 chr7A.!!$F1 571
3 TraesCS7A01G285900 chr7A 506699781 506700354 573 True 931 931 95.993 1 572 1 chr7A.!!$R2 571
4 TraesCS7A01G285900 chr2B 776222960 776224938 1978 False 3567 3567 99.192 571 2549 1 chr2B.!!$F1 1978
5 TraesCS7A01G285900 chr2B 781094238 781096217 1979 False 3557 3557 99.091 570 2549 1 chr2B.!!$F2 1979
6 TraesCS7A01G285900 chr3B 702855679 702857656 1977 True 3559 3559 99.141 571 2549 1 chr3B.!!$R1 1978
7 TraesCS7A01G285900 chr3B 20305087 20307064 1977 False 3554 3554 99.090 572 2549 1 chr3B.!!$F1 1977
8 TraesCS7A01G285900 chr7B 202776911 202778889 1978 False 3557 3557 99.092 568 2549 1 chr7B.!!$F1 1981
9 TraesCS7A01G285900 chr3A 54951909 54953893 1984 False 3555 3555 98.993 565 2549 1 chr3A.!!$F1 1984
10 TraesCS7A01G285900 chr5B 641126802 641128780 1978 True 3554 3554 99.090 572 2549 1 chr5B.!!$R1 1977
11 TraesCS7A01G285900 chr4B 368428391 368430370 1979 True 3552 3552 99.041 570 2549 1 chr4B.!!$R1 1979
12 TraesCS7A01G285900 chr6A 616131291 616133272 1981 False 3550 3550 98.991 568 2549 1 chr6A.!!$F1 1981
13 TraesCS7A01G285900 chr6A 92075955 92076525 570 True 933 933 96.154 1 572 1 chr6A.!!$R1 571
14 TraesCS7A01G285900 chr6A 396114653 396115224 571 True 929 929 95.979 1 572 1 chr6A.!!$R2 571
15 TraesCS7A01G285900 chr2A 190591815 190592385 570 True 944 944 96.503 1 572 1 chr2A.!!$R1 571
16 TraesCS7A01G285900 chr1A 211041410 211041980 570 False 933 933 96.154 1 572 1 chr1A.!!$F1 571
17 TraesCS7A01G285900 chr5A 79725732 79726304 572 False 929 929 95.986 1 572 1 chr5A.!!$F1 571
18 TraesCS7A01G285900 chr5A 618909012 618909583 571 True 929 929 95.986 1 572 1 chr5A.!!$R1 571

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
249 253 0.179023 TTCCTTACGCGGTTGGGTTT 60.179 50.0 12.47 0.0 42.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1777 1785 1.003355 GCCTGCACTTGGCTCTACA 60.003 57.895 8.16 0.0 46.38 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
152 153 2.274542 TGATAAAGGGTGGAAGGCTCA 58.725 47.619 0.00 0.00 0.00 4.26
196 198 1.207329 CACTCTAGCCGCCCTAGTTTT 59.793 52.381 7.83 0.00 43.36 2.43
227 230 3.940221 CGGTGTTATGTTCCCGGATTTTA 59.060 43.478 0.73 0.00 36.84 1.52
249 253 0.179023 TTCCTTACGCGGTTGGGTTT 60.179 50.000 12.47 0.00 42.00 3.27
339 345 2.200373 TTGCCACCTAGCCTCTTTTC 57.800 50.000 0.00 0.00 0.00 2.29
362 368 2.359011 GGGTTTCCGGAGCCCAAT 59.641 61.111 30.32 0.00 41.93 3.16
668 675 4.063967 CCTAGTCCGTGCGCACCA 62.064 66.667 33.23 18.47 0.00 4.17
878 885 2.182791 CACGGCGACAGAGAGCAT 59.817 61.111 16.62 0.00 34.54 3.79
1021 1028 1.913262 TCTTCCTCAAGCTCCCGCA 60.913 57.895 0.00 0.00 39.10 5.69
1777 1785 2.800250 CTCTTGGGCCAAATTCAGAGT 58.200 47.619 21.28 0.00 0.00 3.24
1814 1822 2.704065 GGCTAGACTAATGGGCCAACTA 59.296 50.000 11.89 4.22 42.08 2.24
1858 1866 5.771165 AGGGGTTTTCTTGCGTATTTTTCTA 59.229 36.000 0.00 0.00 0.00 2.10
2039 2047 3.557577 TGTCATGAAAAATGTGCCTCG 57.442 42.857 0.00 0.00 0.00 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 1.064389 GCTGAGCCTTCCACCCTTTAT 60.064 52.381 0.00 0.0 0.00 1.40
196 198 4.500205 GGGAACATAACACCGATATGACGA 60.500 45.833 0.00 0.0 35.28 4.20
1777 1785 1.003355 GCCTGCACTTGGCTCTACA 60.003 57.895 8.16 0.0 46.38 2.74
1814 1822 3.569491 CTGAATGGGCCTAATTGGATGT 58.431 45.455 4.53 0.0 38.35 3.06
2039 2047 1.471153 GCGTAAACCTCTACCAGAGCC 60.471 57.143 0.00 0.0 40.98 4.70
2298 2308 6.307155 CAACATTCACGGTCTCACTATTTTC 58.693 40.000 0.00 0.0 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.