Multiple sequence alignment - TraesCS7A01G279700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G279700 chr7A 100.000 2396 0 0 1 2396 299314109 299311714 0.000000e+00 4425
1 TraesCS7A01G279700 chr7B 99.344 1676 11 0 721 2396 257652461 257654136 0.000000e+00 3035
2 TraesCS7A01G279700 chr5A 99.037 1661 15 1 736 2396 484830714 484832373 0.000000e+00 2977
3 TraesCS7A01G279700 chr5A 97.622 715 16 1 1 714 483519016 483519730 0.000000e+00 1225
4 TraesCS7A01G279700 chr2A 98.746 1675 21 0 722 2396 166818343 166816669 0.000000e+00 2977
5 TraesCS7A01G279700 chr1A 98.455 1683 24 2 714 2396 546232100 546233780 0.000000e+00 2963
6 TraesCS7A01G279700 chr1A 95.028 704 34 1 1 703 2344156 2343453 0.000000e+00 1105
7 TraesCS7A01G279700 chr5B 98.565 1673 18 1 730 2396 47328170 47326498 0.000000e+00 2952
8 TraesCS7A01G279700 chr5B 98.327 1674 21 1 730 2396 47323125 47321452 0.000000e+00 2929
9 TraesCS7A01G279700 chr1B 98.090 1675 18 5 722 2396 526807649 526809309 0.000000e+00 2904
10 TraesCS7A01G279700 chr6B 95.179 1680 74 5 724 2396 246983362 246985041 0.000000e+00 2647
11 TraesCS7A01G279700 chr6B 94.287 1663 84 5 741 2396 420862196 420863854 0.000000e+00 2534
12 TraesCS7A01G279700 chr6B 96.190 630 24 0 1 630 427448354 427447725 0.000000e+00 1031
13 TraesCS7A01G279700 chr5D 97.301 704 18 1 1 703 340568947 340569650 0.000000e+00 1194
14 TraesCS7A01G279700 chr5D 89.041 146 16 0 386 531 371061939 371061794 5.260000e-42 182
15 TraesCS7A01G279700 chr3D 96.170 705 22 5 1 703 146192925 146192224 0.000000e+00 1147
16 TraesCS7A01G279700 chr7D 98.956 383 3 1 1 382 87192098 87192480 0.000000e+00 684
17 TraesCS7A01G279700 chr7D 95.223 314 11 2 391 703 87194124 87194434 5.950000e-136 494
18 TraesCS7A01G279700 chr4B 89.873 395 20 12 308 697 650783182 650783561 7.700000e-135 490
19 TraesCS7A01G279700 chr3A 81.897 232 32 7 2121 2350 521924999 521924776 1.130000e-43 187


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G279700 chr7A 299311714 299314109 2395 True 4425.0 4425 100.0000 1 2396 1 chr7A.!!$R1 2395
1 TraesCS7A01G279700 chr7B 257652461 257654136 1675 False 3035.0 3035 99.3440 721 2396 1 chr7B.!!$F1 1675
2 TraesCS7A01G279700 chr5A 484830714 484832373 1659 False 2977.0 2977 99.0370 736 2396 1 chr5A.!!$F2 1660
3 TraesCS7A01G279700 chr5A 483519016 483519730 714 False 1225.0 1225 97.6220 1 714 1 chr5A.!!$F1 713
4 TraesCS7A01G279700 chr2A 166816669 166818343 1674 True 2977.0 2977 98.7460 722 2396 1 chr2A.!!$R1 1674
5 TraesCS7A01G279700 chr1A 546232100 546233780 1680 False 2963.0 2963 98.4550 714 2396 1 chr1A.!!$F1 1682
6 TraesCS7A01G279700 chr1A 2343453 2344156 703 True 1105.0 1105 95.0280 1 703 1 chr1A.!!$R1 702
7 TraesCS7A01G279700 chr5B 47321452 47328170 6718 True 2940.5 2952 98.4460 730 2396 2 chr5B.!!$R1 1666
8 TraesCS7A01G279700 chr1B 526807649 526809309 1660 False 2904.0 2904 98.0900 722 2396 1 chr1B.!!$F1 1674
9 TraesCS7A01G279700 chr6B 246983362 246985041 1679 False 2647.0 2647 95.1790 724 2396 1 chr6B.!!$F1 1672
10 TraesCS7A01G279700 chr6B 420862196 420863854 1658 False 2534.0 2534 94.2870 741 2396 1 chr6B.!!$F2 1655
11 TraesCS7A01G279700 chr6B 427447725 427448354 629 True 1031.0 1031 96.1900 1 630 1 chr6B.!!$R1 629
12 TraesCS7A01G279700 chr5D 340568947 340569650 703 False 1194.0 1194 97.3010 1 703 1 chr5D.!!$F1 702
13 TraesCS7A01G279700 chr3D 146192224 146192925 701 True 1147.0 1147 96.1700 1 703 1 chr3D.!!$R1 702
14 TraesCS7A01G279700 chr7D 87192098 87194434 2336 False 589.0 684 97.0895 1 703 2 chr7D.!!$F1 702

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
889 2530 4.062293 CCTGTCGTTTGGACTATTCAACA 58.938 43.478 0.0 0.0 46.24 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1696 3345 7.872483 CAGTGGTTTGGTTTCTAAGCATAAAAT 59.128 33.333 0.0 0.0 38.09 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 195 6.441093 GACAACACATATGTCAATGGATGT 57.559 37.500 5.07 5.61 45.13 3.06
715 2356 8.121305 CATATGTGCTAGTCTCTTCCTAATCT 57.879 38.462 0.00 0.00 0.00 2.40
716 2357 9.237187 CATATGTGCTAGTCTCTTCCTAATCTA 57.763 37.037 0.00 0.00 0.00 1.98
717 2358 9.989296 ATATGTGCTAGTCTCTTCCTAATCTAT 57.011 33.333 0.00 0.00 0.00 1.98
718 2359 7.753309 TGTGCTAGTCTCTTCCTAATCTATC 57.247 40.000 0.00 0.00 0.00 2.08
719 2360 6.717540 TGTGCTAGTCTCTTCCTAATCTATCC 59.282 42.308 0.00 0.00 0.00 2.59
844 2485 8.528044 TTGTTTAAGTGGTACTCAGGAAAAAT 57.472 30.769 0.00 0.00 0.00 1.82
889 2530 4.062293 CCTGTCGTTTGGACTATTCAACA 58.938 43.478 0.00 0.00 46.24 3.33
1129 2778 2.203139 TCGCAACCACACACCCAG 60.203 61.111 0.00 0.00 0.00 4.45
1696 3345 5.918426 ATGTGTGGCATAAACATGATCAA 57.082 34.783 0.00 0.00 35.74 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
705 2346 9.403583 GTAGGTAGAGATGGATAGATTAGGAAG 57.596 40.741 0.00 0.0 0.00 3.46
707 2348 8.703142 AGTAGGTAGAGATGGATAGATTAGGA 57.297 38.462 0.00 0.0 0.00 2.94
716 2357 9.091220 GTGGTTTATTAGTAGGTAGAGATGGAT 57.909 37.037 0.00 0.0 0.00 3.41
717 2358 7.230108 CGTGGTTTATTAGTAGGTAGAGATGGA 59.770 40.741 0.00 0.0 0.00 3.41
718 2359 7.368833 CGTGGTTTATTAGTAGGTAGAGATGG 58.631 42.308 0.00 0.0 0.00 3.51
719 2360 6.862090 GCGTGGTTTATTAGTAGGTAGAGATG 59.138 42.308 0.00 0.0 0.00 2.90
844 2485 4.991687 GGGGTTTTACGCAAAAATGAATCA 59.008 37.500 0.00 0.0 39.22 2.57
889 2530 2.665185 GAACTGCTTGGACCGCGT 60.665 61.111 4.92 0.0 0.00 6.01
1129 2778 3.056754 ATGCCCGAAACCCTAGCCC 62.057 63.158 0.00 0.0 0.00 5.19
1696 3345 7.872483 CAGTGGTTTGGTTTCTAAGCATAAAAT 59.128 33.333 0.00 0.0 38.09 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.