Multiple sequence alignment - TraesCS7A01G279200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G279200 chr7A 100.000 2689 0 0 1 2689 296602940 296605628 0.000000e+00 4966
1 TraesCS7A01G279200 chr7A 98.217 2692 45 2 1 2689 305710232 305707541 0.000000e+00 4702
2 TraesCS7A01G279200 chr7A 98.768 1623 19 1 1068 2689 299568843 299567221 0.000000e+00 2885
3 TraesCS7A01G279200 chr7A 99.254 1072 8 0 1 1072 299575280 299574209 0.000000e+00 1936
4 TraesCS7A01G279200 chr7A 96.059 406 16 0 1 406 704664628 704665033 0.000000e+00 662
5 TraesCS7A01G279200 chr7B 93.373 2520 100 15 230 2689 511463314 511460802 0.000000e+00 3666
6 TraesCS7A01G279200 chr7B 95.813 406 17 0 1 406 45648732 45648327 0.000000e+00 656
7 TraesCS7A01G279200 chr7B 92.308 117 8 1 1301 1417 741544746 741544861 5.960000e-37 165
8 TraesCS7A01G279200 chr6A 99.011 1415 13 1 159 1573 58305377 58306790 0.000000e+00 2534
9 TraesCS7A01G279200 chr6A 97.143 140 4 0 2547 2686 58306790 58306929 1.240000e-58 237
10 TraesCS7A01G279200 chr2B 95.752 1177 27 2 1 1177 296070381 296069228 0.000000e+00 1875
11 TraesCS7A01G279200 chr2B 95.571 858 15 10 1203 2038 296067583 296066727 0.000000e+00 1352
12 TraesCS7A01G279200 chr2B 96.172 653 24 1 2037 2689 296066646 296065995 0.000000e+00 1066
13 TraesCS7A01G279200 chr2B 92.560 457 28 3 1406 1856 695410264 695409808 0.000000e+00 651
14 TraesCS7A01G279200 chr2B 91.250 480 26 5 1743 2214 695436643 695436172 8.120000e-180 640
15 TraesCS7A01G279200 chr2B 84.740 557 64 14 603 1146 542672888 542673436 3.050000e-149 538
16 TraesCS7A01G279200 chr2B 92.669 341 21 1 1406 1742 695436951 695436611 3.110000e-134 488
17 TraesCS7A01G279200 chr2B 91.176 204 17 1 2339 2541 542673803 542674006 2.640000e-70 276
18 TraesCS7A01G279200 chr2B 95.745 141 6 0 1164 1304 695410405 695410265 7.490000e-56 228
19 TraesCS7A01G279200 chr2B 95.745 141 6 0 1164 1304 695437092 695436952 7.490000e-56 228
20 TraesCS7A01G279200 chr2B 94.656 131 6 1 2084 2214 695409790 695409661 4.540000e-48 202
21 TraesCS7A01G279200 chr2A 90.449 1068 50 13 1164 2207 715964448 715963409 0.000000e+00 1360
22 TraesCS7A01G279200 chr2A 96.305 406 15 0 1 406 648745474 648745069 0.000000e+00 667
23 TraesCS7A01G279200 chr2A 82.941 340 49 5 1407 1739 716169426 716169763 5.630000e-77 298
24 TraesCS7A01G279200 chr3A 92.266 918 51 8 1778 2685 71265643 71266550 0.000000e+00 1284
25 TraesCS7A01G279200 chr2D 92.243 838 43 8 1389 2214 577827666 577826839 0.000000e+00 1168
26 TraesCS7A01G279200 chr2D 87.395 119 15 0 1184 1302 577800698 577800580 1.300000e-28 137
27 TraesCS7A01G279200 chr1A 96.305 406 15 0 1 406 315270374 315269969 0.000000e+00 667
28 TraesCS7A01G279200 chr4B 95.813 406 17 0 1 406 167919152 167918747 0.000000e+00 656
29 TraesCS7A01G279200 chr5A 82.420 529 50 29 636 1154 475381544 475382039 3.200000e-114 422
30 TraesCS7A01G279200 chr5B 82.231 529 51 29 636 1154 640418772 640419267 1.490000e-112 416
31 TraesCS7A01G279200 chr5B 93.805 113 6 1 1301 1413 650990197 650990086 4.600000e-38 169
32 TraesCS7A01G279200 chrUn 82.075 530 52 29 636 1154 62072678 62073175 1.930000e-111 412
33 TraesCS7A01G279200 chr4D 94.545 110 5 1 1301 1410 441486708 441486816 4.600000e-38 169
34 TraesCS7A01G279200 chr5D 92.373 118 7 2 1299 1416 302746277 302746162 1.660000e-37 167
35 TraesCS7A01G279200 chr3B 87.805 123 15 0 2330 2452 668821254 668821132 7.760000e-31 145


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G279200 chr7A 296602940 296605628 2688 False 4966.000000 4966 100.000000 1 2689 1 chr7A.!!$F1 2688
1 TraesCS7A01G279200 chr7A 305707541 305710232 2691 True 4702.000000 4702 98.217000 1 2689 1 chr7A.!!$R3 2688
2 TraesCS7A01G279200 chr7A 299567221 299568843 1622 True 2885.000000 2885 98.768000 1068 2689 1 chr7A.!!$R1 1621
3 TraesCS7A01G279200 chr7A 299574209 299575280 1071 True 1936.000000 1936 99.254000 1 1072 1 chr7A.!!$R2 1071
4 TraesCS7A01G279200 chr7B 511460802 511463314 2512 True 3666.000000 3666 93.373000 230 2689 1 chr7B.!!$R2 2459
5 TraesCS7A01G279200 chr6A 58305377 58306929 1552 False 1385.500000 2534 98.077000 159 2686 2 chr6A.!!$F1 2527
6 TraesCS7A01G279200 chr2B 296065995 296070381 4386 True 1431.000000 1875 95.831667 1 2689 3 chr2B.!!$R1 2688
7 TraesCS7A01G279200 chr2B 695436172 695437092 920 True 452.000000 640 93.221333 1164 2214 3 chr2B.!!$R3 1050
8 TraesCS7A01G279200 chr2B 542672888 542674006 1118 False 407.000000 538 87.958000 603 2541 2 chr2B.!!$F1 1938
9 TraesCS7A01G279200 chr2B 695409661 695410405 744 True 360.333333 651 94.320333 1164 2214 3 chr2B.!!$R2 1050
10 TraesCS7A01G279200 chr2A 715963409 715964448 1039 True 1360.000000 1360 90.449000 1164 2207 1 chr2A.!!$R2 1043
11 TraesCS7A01G279200 chr3A 71265643 71266550 907 False 1284.000000 1284 92.266000 1778 2685 1 chr3A.!!$F1 907
12 TraesCS7A01G279200 chr2D 577826839 577827666 827 True 1168.000000 1168 92.243000 1389 2214 1 chr2D.!!$R2 825

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
976 1015 4.334759 CCAGAGTGCAGATATTTCTTGGTG 59.665 45.833 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2645 4471 1.751924 ACGCTTTATTCTCTCCGAGCT 59.248 47.619 0.0 0.0 0.0 4.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 332 5.242838 GTGCTCTACTCTATACCTCATGCTT 59.757 44.000 0.00 0.00 0.00 3.91
665 693 7.787904 TGGTACTTTCTGGGTATGTGTATAGAT 59.212 37.037 0.00 0.00 0.00 1.98
712 740 8.773404 TGTTTGCTTAACTATTACTCTTCTCC 57.227 34.615 4.36 0.00 37.64 3.71
976 1015 4.334759 CCAGAGTGCAGATATTTCTTGGTG 59.665 45.833 0.00 0.00 0.00 4.17
1580 3253 9.630098 TTACAATCATTCAAAGAAGCTTTGATC 57.370 29.630 19.61 0.00 38.12 2.92
1724 3441 0.469494 TGTCTTGAGAGCAGGTGCAA 59.531 50.000 4.48 0.00 45.16 4.08
2328 4153 5.825593 AGAAGGTCAGATAAGTTGTTCCA 57.174 39.130 0.00 0.00 0.00 3.53
2618 4444 1.828602 TTGGTAGGGCCCCTCCACTA 61.829 60.000 28.57 16.42 33.10 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 332 7.012894 AGTCAAAACGAAAAGTACAATCATCCA 59.987 33.333 0.00 0.00 0.00 3.41
665 693 9.699410 AAACAATCTAAATACATGAGGGATTCA 57.301 29.630 0.00 0.00 40.85 2.57
712 740 9.840427 ATTAAGTTATCACAAAGTCGGAAAATG 57.160 29.630 0.00 0.00 0.00 2.32
976 1015 6.042143 TCCATCTTTTCTTGAAAGCAAACAC 58.958 36.000 0.00 0.00 43.61 3.32
1580 3253 4.801891 CAACATTTGTGTCATCCTCCTTG 58.198 43.478 0.00 0.00 0.00 3.61
1693 3410 3.412386 TCTCAAGACACGATCTCTCACA 58.588 45.455 0.00 0.00 36.27 3.58
2270 4095 4.025360 TGCAGGATAATGGAATTGCAAGT 58.975 39.130 2.94 0.59 38.47 3.16
2618 4444 9.700831 ACTTGTTAAAAGGATATCCAGCTTATT 57.299 29.630 23.81 5.21 38.89 1.40
2645 4471 1.751924 ACGCTTTATTCTCTCCGAGCT 59.248 47.619 0.00 0.00 0.00 4.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.