Multiple sequence alignment - TraesCS7A01G262300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G262300 chr7A 100.000 2201 0 0 1 2201 258305488 258307688 0.000000e+00 4065
1 TraesCS7A01G262300 chr2A 98.865 2202 24 1 1 2201 726901129 726903330 0.000000e+00 3927
2 TraesCS7A01G262300 chr2A 97.184 2202 59 3 1 2201 335800748 335802947 0.000000e+00 3720
3 TraesCS7A01G262300 chr2A 97.484 2146 50 4 1 2144 335822035 335824178 0.000000e+00 3661
4 TraesCS7A01G262300 chr2A 98.383 1546 25 0 103 1648 651438618 651437073 0.000000e+00 2717
5 TraesCS7A01G262300 chr2A 96.618 887 28 2 1316 2201 335818793 335819678 0.000000e+00 1471
6 TraesCS7A01G262300 chr2A 99.310 145 1 0 1 145 543186476 543186332 1.680000e-66 263
7 TraesCS7A01G262300 chr3B 98.547 2202 31 1 1 2201 201569461 201571662 0.000000e+00 3888
8 TraesCS7A01G262300 chr7B 98.456 2202 32 2 1 2201 663094100 663096300 0.000000e+00 3877
9 TraesCS7A01G262300 chr7B 98.411 2202 33 2 1 2201 662732239 662730039 0.000000e+00 3871
10 TraesCS7A01G262300 chr3D 98.455 2201 34 0 1 2201 589258202 589260402 0.000000e+00 3877
11 TraesCS7A01G262300 chr6B 98.229 2202 38 1 1 2201 450085128 450082927 0.000000e+00 3849


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G262300 chr7A 258305488 258307688 2200 False 4065 4065 100.000 1 2201 1 chr7A.!!$F1 2200
1 TraesCS7A01G262300 chr2A 726901129 726903330 2201 False 3927 3927 98.865 1 2201 1 chr2A.!!$F2 2200
2 TraesCS7A01G262300 chr2A 335800748 335802947 2199 False 3720 3720 97.184 1 2201 1 chr2A.!!$F1 2200
3 TraesCS7A01G262300 chr2A 651437073 651438618 1545 True 2717 2717 98.383 103 1648 1 chr2A.!!$R2 1545
4 TraesCS7A01G262300 chr2A 335818793 335824178 5385 False 2566 3661 97.051 1 2201 2 chr2A.!!$F3 2200
5 TraesCS7A01G262300 chr3B 201569461 201571662 2201 False 3888 3888 98.547 1 2201 1 chr3B.!!$F1 2200
6 TraesCS7A01G262300 chr7B 663094100 663096300 2200 False 3877 3877 98.456 1 2201 1 chr7B.!!$F1 2200
7 TraesCS7A01G262300 chr7B 662730039 662732239 2200 True 3871 3871 98.411 1 2201 1 chr7B.!!$R1 2200
8 TraesCS7A01G262300 chr3D 589258202 589260402 2200 False 3877 3877 98.455 1 2201 1 chr3D.!!$F1 2200
9 TraesCS7A01G262300 chr6B 450082927 450085128 2201 True 3849 3849 98.229 1 2201 1 chr6B.!!$R1 2200

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
549 3792 0.383491 CATCGAGCTATTTTGCCGCG 60.383 55.0 0.0 0.0 34.23 6.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1861 5107 1.070134 GGCGTAATGATCTGGGCACTA 59.93 52.381 0.0 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 3281 2.661593 ACCCTTAGGAGTAGGTAACCCA 59.338 50.000 0.00 0.0 36.73 4.51
149 3392 9.495572 GAGCATACCTAAGTTCAATAGCTTTAT 57.504 33.333 0.00 0.0 0.00 1.40
549 3792 0.383491 CATCGAGCTATTTTGCCGCG 60.383 55.000 0.00 0.0 34.23 6.46
681 3924 8.375506 ACGAGGAAAGGCATGAGATAAATATTA 58.624 33.333 0.00 0.0 0.00 0.98
995 4239 2.363680 CCATACTTCTGTCGCTCCATCT 59.636 50.000 0.00 0.0 0.00 2.90
1290 4534 1.200483 CAGCTCACGTACCGCATTAG 58.800 55.000 0.00 0.0 0.00 1.73
1637 4881 1.152030 TGAGACTGTCCCTTGGCCT 60.152 57.895 3.32 0.0 0.00 5.19
1861 5107 1.228124 CCGAGCCTCTCTCCGAGAT 60.228 63.158 0.00 0.0 42.62 2.75
1874 5120 1.133482 TCCGAGATAGTGCCCAGATCA 60.133 52.381 0.00 0.0 0.00 2.92
2059 5305 3.120321 ACATGGTCTTACGACTTTGCA 57.880 42.857 0.00 0.0 40.10 4.08
2083 5329 5.891551 AGAGACCTGTGTTTTTGGTAAACAT 59.108 36.000 6.38 0.0 41.51 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
149 3392 0.603065 CATGATCGGGATAGCGGACA 59.397 55.000 0.00 0.00 0.00 4.02
289 3532 3.640407 GTGGAGACAGCTGGGCCA 61.640 66.667 19.93 18.35 44.46 5.36
681 3924 2.576191 TGGGGCTTCACAATTACTAGCT 59.424 45.455 0.00 0.00 32.58 3.32
995 4239 2.599216 GGTTCTCCACCCATACGGA 58.401 57.895 0.00 0.00 40.19 4.69
1637 4881 1.978455 AACCTTGTGTCAGACCCGCA 61.978 55.000 0.00 0.00 0.00 5.69
1861 5107 1.070134 GGCGTAATGATCTGGGCACTA 59.930 52.381 0.00 0.00 0.00 2.74
2059 5305 5.258051 TGTTTACCAAAAACACAGGTCTCT 58.742 37.500 0.00 0.00 35.45 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.