Multiple sequence alignment - TraesCS7A01G238300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G238300 chr7A 100.000 2315 0 0 1 2315 211377606 211379920 0 4276
1 TraesCS7A01G238300 chr7B 98.014 2316 40 3 1 2315 743095878 743098188 0 4017
2 TraesCS7A01G238300 chr7B 97.927 2316 42 3 1 2315 644446415 644448725 0 4006
3 TraesCS7A01G238300 chr7B 96.934 2316 63 5 1 2315 54063142 54065450 0 3877
4 TraesCS7A01G238300 chrUn 97.971 2316 40 4 1 2315 170995029 170992720 0 4010
5 TraesCS7A01G238300 chr6B 97.496 2316 51 4 1 2315 307014535 307012226 0 3949
6 TraesCS7A01G238300 chr1A 97.237 2316 57 4 1 2315 94677206 94679515 0 3916
7 TraesCS7A01G238300 chr1B 97.150 2316 59 4 1 2315 672527980 672525671 0 3904
8 TraesCS7A01G238300 chr4B 97.021 2316 59 6 1 2315 623334086 623331780 0 3886
9 TraesCS7A01G238300 chr3B 96.503 2316 72 7 1 2315 39863840 39861533 0 3819


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G238300 chr7A 211377606 211379920 2314 False 4276 4276 100.000 1 2315 1 chr7A.!!$F1 2314
1 TraesCS7A01G238300 chr7B 743095878 743098188 2310 False 4017 4017 98.014 1 2315 1 chr7B.!!$F3 2314
2 TraesCS7A01G238300 chr7B 644446415 644448725 2310 False 4006 4006 97.927 1 2315 1 chr7B.!!$F2 2314
3 TraesCS7A01G238300 chr7B 54063142 54065450 2308 False 3877 3877 96.934 1 2315 1 chr7B.!!$F1 2314
4 TraesCS7A01G238300 chrUn 170992720 170995029 2309 True 4010 4010 97.971 1 2315 1 chrUn.!!$R1 2314
5 TraesCS7A01G238300 chr6B 307012226 307014535 2309 True 3949 3949 97.496 1 2315 1 chr6B.!!$R1 2314
6 TraesCS7A01G238300 chr1A 94677206 94679515 2309 False 3916 3916 97.237 1 2315 1 chr1A.!!$F1 2314
7 TraesCS7A01G238300 chr1B 672525671 672527980 2309 True 3904 3904 97.150 1 2315 1 chr1B.!!$R1 2314
8 TraesCS7A01G238300 chr4B 623331780 623334086 2306 True 3886 3886 97.021 1 2315 1 chr4B.!!$R1 2314
9 TraesCS7A01G238300 chr3B 39861533 39863840 2307 True 3819 3819 96.503 1 2315 1 chr3B.!!$R1 2314

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
536 538 0.182775 AACCGTGCAGGAAGGTTTCT 59.817 50.0 8.24 0.0 43.23 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1611 1618 0.675083 TCCCGTCTTGCGTAACTGAA 59.325 50.0 0.0 0.0 39.32 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 4.706476 CCAAGAGCTAATCCAAAATCACCA 59.294 41.667 0.00 0.00 0.00 4.17
128 129 4.706962 AGAGCTAATCCAAAATCACCAACC 59.293 41.667 0.00 0.00 0.00 3.77
525 527 3.611674 TGCTCTCCGAACCGTGCA 61.612 61.111 0.00 0.00 0.00 4.57
536 538 0.182775 AACCGTGCAGGAAGGTTTCT 59.817 50.000 8.24 0.00 43.23 2.52
600 602 2.033424 GTCAGAACAGTCCTGGCAAAAC 59.967 50.000 0.00 0.00 36.35 2.43
694 696 5.015178 TCCCTAATCCAAAAATGAGTCCACT 59.985 40.000 0.00 0.00 0.00 4.00
800 802 2.521547 AGGCTGGATCAAGAAAAGGG 57.478 50.000 0.00 0.00 0.00 3.95
801 803 1.006400 AGGCTGGATCAAGAAAAGGGG 59.994 52.381 0.00 0.00 0.00 4.79
802 804 1.478631 GCTGGATCAAGAAAAGGGGG 58.521 55.000 0.00 0.00 0.00 5.40
855 859 2.434884 CCAGCTCGCGTGGTTCAT 60.435 61.111 10.52 0.00 0.00 2.57
864 868 1.024579 GCGTGGTTCATCGGTTCCAT 61.025 55.000 0.00 0.00 32.45 3.41
1094 1098 4.157105 TCAACTGTGTATCGATCGAAAGGA 59.843 41.667 23.50 5.08 0.00 3.36
1099 1103 3.067742 GTGTATCGATCGAAAGGAAGGGA 59.932 47.826 23.50 0.00 0.00 4.20
1118 1122 2.610859 ACAGAGCCCCCAACCGAT 60.611 61.111 0.00 0.00 0.00 4.18
1220 1224 2.416296 CCGTATCACCGCAGAACAACTA 60.416 50.000 0.00 0.00 0.00 2.24
1281 1285 0.462225 TGACTTCACGGTCGCCAAAA 60.462 50.000 0.00 0.00 38.91 2.44
1323 1327 3.144506 ACATTTCCGATGAGATCCATGC 58.855 45.455 1.91 0.00 35.17 4.06
1335 1339 4.102054 TGAGATCCATGCAGCTATTCTGAA 59.898 41.667 0.00 0.00 45.72 3.02
1611 1618 3.627577 ACTTTCGACTTGATTTGCAGTGT 59.372 39.130 0.00 0.00 0.00 3.55
1800 1807 5.226194 AGAAGAGAGACAACATTCAAGCT 57.774 39.130 0.00 0.00 0.00 3.74
1879 1886 8.317679 GGTGCATAACAGATCTTTCCTATCTAT 58.682 37.037 0.00 0.00 32.40 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 2.017049 GCTATGCTTGTCAATCGGGTT 58.983 47.619 0.00 0.00 0.00 4.11
525 527 2.289694 CCGTGTGATGAGAAACCTTCCT 60.290 50.000 0.00 0.00 0.00 3.36
536 538 0.602638 GTTGGTGAGCCGTGTGATGA 60.603 55.000 0.00 0.00 37.67 2.92
589 591 1.134037 ACCGTACTTGTTTTGCCAGGA 60.134 47.619 0.00 0.00 0.00 3.86
600 602 1.067776 AGGAAAGCGAGACCGTACTTG 60.068 52.381 0.00 0.00 38.24 3.16
803 805 1.831726 GAGGGCTCGTAGTACCCCC 60.832 68.421 8.95 9.15 43.09 5.40
855 859 1.210931 GTGACGTCGATGGAACCGA 59.789 57.895 11.62 0.00 0.00 4.69
864 868 3.118482 ACTCTATCTAAGGGTGACGTCGA 60.118 47.826 11.62 0.00 37.60 4.20
1094 1098 2.285743 GGGGGCTCTGTCTCCCTT 60.286 66.667 0.00 0.00 42.25 3.95
1099 1103 3.322466 CGGTTGGGGGCTCTGTCT 61.322 66.667 0.00 0.00 0.00 3.41
1118 1122 2.592102 ACTGGACGTAACTACTCCCA 57.408 50.000 0.00 0.00 0.00 4.37
1220 1224 0.753479 AGATCAGATCCGGACGCTGT 60.753 55.000 26.56 17.84 0.00 4.40
1281 1285 0.700564 TGATGCTTCTTGGGGCTTCT 59.299 50.000 0.88 0.00 34.90 2.85
1387 1391 6.020984 CACGTGCATTTCATTTTCTTCGATA 58.979 36.000 0.82 0.00 0.00 2.92
1611 1618 0.675083 TCCCGTCTTGCGTAACTGAA 59.325 50.000 0.00 0.00 39.32 3.02
1800 1807 4.342378 GTCTCATACCTCAGTCCATTGCTA 59.658 45.833 0.00 0.00 0.00 3.49
1879 1886 3.198068 GCTTATGCACCGAGAAAGATCA 58.802 45.455 0.00 0.00 39.41 2.92
1923 1930 6.015940 AGGTCTATTGGCTTTATTGCTTATGC 60.016 38.462 0.00 0.00 40.20 3.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.