Multiple sequence alignment - TraesCS7A01G238200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G238200 chr7A 100.000 2234 0 0 1 2234 211364403 211366636 0 4126
1 TraesCS7A01G238200 chr7A 97.506 2245 45 5 1 2234 638507640 638509884 0 3825
2 TraesCS7A01G238200 chr7D 97.588 2239 49 3 1 2234 382089823 382087585 0 3831
3 TraesCS7A01G238200 chr7D 97.279 2242 50 5 1 2234 626711171 626713409 0 3792
4 TraesCS7A01G238200 chr6B 97.372 2245 47 6 1 2234 596601834 596604077 0 3808
5 TraesCS7A01G238200 chr4D 97.366 2240 52 5 1 2234 123401543 123399305 0 3803
6 TraesCS7A01G238200 chrUn 97.282 2244 51 4 1 2234 171008310 171006067 0 3797
7 TraesCS7A01G238200 chr1A 97.140 2238 56 4 1 2234 94663917 94666150 0 3771
8 TraesCS7A01G238200 chr5B 96.972 2246 56 6 1 2234 567280020 567277775 0 3760


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G238200 chr7A 211364403 211366636 2233 False 4126 4126 100.000 1 2234 1 chr7A.!!$F1 2233
1 TraesCS7A01G238200 chr7A 638507640 638509884 2244 False 3825 3825 97.506 1 2234 1 chr7A.!!$F2 2233
2 TraesCS7A01G238200 chr7D 382087585 382089823 2238 True 3831 3831 97.588 1 2234 1 chr7D.!!$R1 2233
3 TraesCS7A01G238200 chr7D 626711171 626713409 2238 False 3792 3792 97.279 1 2234 1 chr7D.!!$F1 2233
4 TraesCS7A01G238200 chr6B 596601834 596604077 2243 False 3808 3808 97.372 1 2234 1 chr6B.!!$F1 2233
5 TraesCS7A01G238200 chr4D 123399305 123401543 2238 True 3803 3803 97.366 1 2234 1 chr4D.!!$R1 2233
6 TraesCS7A01G238200 chrUn 171006067 171008310 2243 True 3797 3797 97.282 1 2234 1 chrUn.!!$R1 2233
7 TraesCS7A01G238200 chr1A 94663917 94666150 2233 False 3771 3771 97.140 1 2234 1 chr1A.!!$F1 2233
8 TraesCS7A01G238200 chr5B 567277775 567280020 2245 True 3760 3760 96.972 1 2234 1 chr5B.!!$R1 2233

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
997 1005 0.546598 CCCGTAGAGGAAAGCCCAAT 59.453 55.0 0.0 0.0 45.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1871 1896 1.072505 GACGAGGAACAAAGGGCCA 59.927 57.895 6.18 0.0 0.0 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 7.598118 AGATGCATTCAAGTCGATCTATTACAG 59.402 37.037 0.00 0.0 0.00 2.74
81 82 3.296943 CGCGGTTGTTCGTATTTCATTTG 59.703 43.478 0.00 0.0 0.00 2.32
156 157 6.431543 ACTTACTGAATCTCGTCTTTCTCTCA 59.568 38.462 0.00 0.0 0.00 3.27
157 158 5.713792 ACTGAATCTCGTCTTTCTCTCAA 57.286 39.130 0.00 0.0 0.00 3.02
397 401 2.423898 CCCGGTCGCCTGTCTATGT 61.424 63.158 0.00 0.0 0.00 2.29
505 509 2.668550 GCCTCCTGCGGTCGTTTT 60.669 61.111 0.00 0.0 0.00 2.43
664 668 2.898612 TGTAACCGTCACCTGTAATCCA 59.101 45.455 0.00 0.0 0.00 3.41
758 765 2.370189 CAGACCCAGGAGTTCACTTTCT 59.630 50.000 0.00 0.0 0.00 2.52
772 779 5.072040 TCACTTTCTCGTATGAGCATTCA 57.928 39.130 7.11 0.0 42.26 2.57
964 972 3.714280 AGGGGTTTATTGCACAAAAAGGT 59.286 39.130 0.00 0.0 0.00 3.50
965 973 4.165180 AGGGGTTTATTGCACAAAAAGGTT 59.835 37.500 0.00 0.0 0.00 3.50
971 979 1.561643 TGCACAAAAAGGTTGGGACA 58.438 45.000 0.00 0.0 0.00 4.02
997 1005 0.546598 CCCGTAGAGGAAAGCCCAAT 59.453 55.000 0.00 0.0 45.00 3.16
1077 1089 3.463048 AAAGAGCAGACCCCATTGAAT 57.537 42.857 0.00 0.0 0.00 2.57
1128 1140 2.583441 CCACCTTCTCACGGAGCCA 61.583 63.158 0.00 0.0 0.00 4.75
1171 1183 2.282674 CTCCCAGCCAGCAAGCAA 60.283 61.111 0.55 0.0 34.23 3.91
1323 1335 4.438336 CGCATTTTAGGTCGAGTAGAGACA 60.438 45.833 0.00 0.0 40.20 3.41
1418 1430 2.905415 TCAAGGGGCATTTGACATCT 57.095 45.000 0.00 0.0 30.03 2.90
1573 1585 6.330178 AGCCTCTAAAGACTCTACTCCTAA 57.670 41.667 0.00 0.0 0.00 2.69
1763 1788 1.003476 GCGTTTCCGGTAAAGGGGA 60.003 57.895 0.00 0.0 34.28 4.81
1871 1896 5.151454 AGAGGTAATTTCGATGATCTCCCT 58.849 41.667 0.00 0.0 0.00 4.20
1896 1921 2.549992 CCTTTGTTCCTCGTCACCATCA 60.550 50.000 0.00 0.0 0.00 3.07
2207 2233 0.617820 CACCACCCCTACTACTGCCT 60.618 60.000 0.00 0.0 0.00 4.75
2226 2252 2.892852 CCTGAAATCCTGCTTTGGTGAA 59.107 45.455 0.00 0.0 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 5.463392 GCTGTAATAGATCGACTTGAATGCA 59.537 40.000 0.00 0.0 0.00 3.96
81 82 3.028366 GCGTCGGCTTGGAAGAAGC 62.028 63.158 0.00 0.0 42.30 3.86
180 181 1.320344 CCGAACCTCTGATCGACCCA 61.320 60.000 1.01 0.0 41.43 4.51
390 394 3.187211 GCTGCTCGCCTACATAGAC 57.813 57.895 0.00 0.0 0.00 2.59
505 509 1.630369 AGCCAGCCAATTGAGTCACTA 59.370 47.619 7.12 0.0 0.00 2.74
565 569 0.404040 GGGCGGGGATAATCATTCCA 59.596 55.000 0.00 0.0 34.77 3.53
772 779 9.869667 ACTCTTCCACTGACTTATATATGTACT 57.130 33.333 1.48 0.0 0.00 2.73
997 1005 1.820519 GGGCTTTGCATCTGACATTCA 59.179 47.619 0.00 0.0 0.00 2.57
1077 1089 2.291209 TGTTGTACCTCACTCCCGTA 57.709 50.000 0.00 0.0 0.00 4.02
1171 1183 6.613271 TCCATGACTTCTAGAGGAAAGCTAAT 59.387 38.462 9.14 0.0 33.07 1.73
1323 1335 0.117340 AAGCCCACAGACTCCCTAGT 59.883 55.000 0.00 0.0 39.21 2.57
1418 1430 2.703536 TGTGGGACTGCTTTTGTCTCTA 59.296 45.455 0.00 0.0 36.01 2.43
1871 1896 1.072505 GACGAGGAACAAAGGGCCA 59.927 57.895 6.18 0.0 0.00 5.36
1896 1921 3.869246 CCGCGTCTCCTTATTGTTATTGT 59.131 43.478 4.92 0.0 0.00 2.71
2207 2233 3.565307 AGTTCACCAAAGCAGGATTTCA 58.435 40.909 0.00 0.0 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.